G226426


Basic Information

Item Value
gene id G226426
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 3472031 ~ 3472447 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU256917
GTATATAGTATTCCTAGCATTGATACATTACCCCTACAAGATGTTAACCCCACTCATACTAGATTAACATCTTTGTGCAAAGATGCTTATTTCAGGATCCTCTCTCTTAATATATCTGAACCTCTTGAACCTCCCTGGACCTCAATTTACCCCAGGAATGATGTGAAATTACATGTCAATAACACTGATTTGCCTTGTTTCTGGATTCTACCCTCCCCCGGTCAGAGTCTTGTGGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU256917 True 236 lncRNA 0.40 2 3472031 3472447

Neighbor

gene id symbol gene type direction distance location
CI01000053_03448295_03455864 NA coding upstream 16091 3447231 ~ 3455940 (+)
CI01000053_03405451_03427728 PDCD5.S, PDCD5 coding upstream 43883 3405052 ~ 3428148 (+)
CI01000053_03318431_03325229 NA coding upstream 146518 3317222 ~ 3325513 (+)
CI01000053_03227130_03234740 CD151, CD151L coding upstream 237291 3227130 ~ 3234740 (+)
CI01000053_03088253_03119757 DHX36 coding upstream 352149 3088253 ~ 3119882 (+)
CI01000053_03484197_03496907 NA coding downstream 11283 3483730 ~ 3497830 (+)
CI01000053_03520283_03525417 NA coding downstream 47585 3520032 ~ 3525462 (+)
CI01000053_03545885_03548117 NA coding downstream 73438 3545885 ~ 3548789 (+)
CI01000053_03572527_03585944 NA coding downstream 99141 3571588 ~ 3586271 (+)
CI01000053_03587596_03590525 NA coding downstream 114335 3586782 ~ 3590558 (+)
G226332 NA non-coding upstream 286308 3185514 ~ 3185723 (+)
G226257 NA non-coding upstream 391880 3079904 ~ 3080151 (+)
G226268 NA non-coding upstream 407896 3031203 ~ 3064135 (+)
G226392 NA non-coding downstream 36233 3508680 ~ 3511385 (+)
G226438 NA non-coding downstream 61728 3534175 ~ 3541583 (+)
G226443 NA non-coding downstream 68388 3540835 ~ 3541368 (+)
G226451 NA non-coding downstream 105596 3578043 ~ 3578316 (+)
G226466 NA non-coding downstream 197471 3669918 ~ 3674199 (+)
G226347 NA other upstream 197120 3272374 ~ 3274911 (+)
G226292 NA other upstream 425248 3036602 ~ 3046783 (+)
CI01000053_02594164_02594541 DYNLL6, DYNLL1, DYNLL2A, DYNLL2, BRAFLDRAFT_114344, DYL1, DYNLL1.S, BRAFLDRAFT_130244, DYNLL1.L other upstream 876564 2592558 ~ 2595467 (+)
G225952 NA other upstream 1598736 1872874 ~ 1873295 (+)
G226399 NA other downstream 148351 3620798 ~ 3697529 (+)
G227317 NA other downstream 942504 4414951 ~ 4415593 (+)
G228257 NA other downstream 1903106 5375553 ~ 5378449 (+)
CI01000053_05471449_05512831 LRRC75B other downstream 2036797 5471449 ~ 5513074 (+)
CI01000053_06725452_06758944 NA other downstream 3250752 6725452 ~ 6758944 (+)

Expression


Co-expression Network