G227851


Basic Information

Item Value
gene id G227851
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 4819576 ~ 4819879 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU258583
CATGGCTTAATGGTTAGAGAGTCGGACTGGTAACCCAAAGGTTGCAGGTTCAGTTCTCAATACTGGCTGGAAATAACTGAGGTGCCCTTGAGCAAGGCACCTAACCCCCAATCGCTCCCTGGGCGCCACAGCAAAATGGCTGTGTATGTCCACGGTTTGCAGTGTATACATACTCACTACTCCTAATGTGTGCATGCTAACTTGGATGGGTTAAATACAGAGGACAAATTATGAGTATGGGTTACCATACTTGGCCTTCATGTGTCACTTTCAAAATATCTATGAAAATATAAATCACTTCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU258583 True 304 lncRNA 0.44 1 4819576 4819879

Neighbor

gene id symbol gene type direction distance location
CI01000053_04725274_04746721 NA coding upstream 72208 4724511 ~ 4747368 (+)
CI01000053_04714218_04716351 KAZALD3, KAZALD1 coding upstream 103042 4713891 ~ 4716534 (+)
CI01000053_04668583_04699797 KIAA1671 coding upstream 117898 4668583 ~ 4701678 (+)
CI01000053_04399676_04409215 CCDC92 coding upstream 410361 4399676 ~ 4409215 (+)
CI01000053_04194890_04254244 NCOR2 coding upstream 565114 4194890 ~ 4254462 (+)
CI01000053_04887190_04967327 GFRA2A coding downstream 67311 4887190 ~ 4967327 (+)
CI01000053_05187818_05191994 NA coding downstream 367814 5187693 ~ 5192234 (+)
CI01000053_05214150_05219071 NA coding downstream 394271 5214150 ~ 5220330 (+)
CI01000053_05235005_05242054 PRKAB1B, PRKAB1 coding downstream 413828 5233707 ~ 5242337 (+)
CI01000053_05253537_05256485 PLA2G1B coding downstream 433614 5253493 ~ 5256998 (+)
G227835 NA non-coding upstream 35792 4783566 ~ 4783784 (+)
G227815 NA non-coding upstream 59800 4759472 ~ 4759776 (+)
G227813 NA non-coding upstream 63706 4755666 ~ 4755870 (+)
G227466 NA non-coding upstream 280800 4506849 ~ 4538776 (+)
G227439 NA non-coding upstream 324653 4493366 ~ 4494923 (+)
G227891 NA non-coding downstream 145217 4965096 ~ 4965422 (+)
G227897 NA non-coding downstream 173390 4993269 ~ 4993485 (+)
G227901 NA non-coding downstream 175474 4995353 ~ 4995948 (+)
G227917 NA non-coding downstream 194581 5014460 ~ 5014669 (+)
G227924 NA non-coding downstream 217751 5037630 ~ 5037844 (+)
G227317 NA other upstream 403983 4414951 ~ 4415593 (+)
G226399 NA other upstream 1122047 3620798 ~ 3697529 (+)
G226347 NA other upstream 1544665 3272374 ~ 3274911 (+)
G226292 NA other upstream 1772793 3036602 ~ 3046783 (+)
CI01000053_02594164_02594541 DYNLL6, DYNLL1, DYNLL2A, DYNLL2, BRAFLDRAFT_114344, DYL1, DYNLL1.S, BRAFLDRAFT_130244, DYNLL1.L other upstream 2224109 2592558 ~ 2595467 (+)
G228257 NA other downstream 555674 5375553 ~ 5378449 (+)
CI01000053_05471449_05512831 LRRC75B other downstream 689365 5471449 ~ 5513074 (+)
CI01000053_06725452_06758944 NA other downstream 1903320 6725452 ~ 6758944 (+)

Expression


Co-expression Network