G228317


Basic Information

Item Value
gene id G228317
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 5430357 ~ 5430563 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU259078
GGGATAGGACTCGGGAAGTAATCATGTTCATGGATGCGATTATTAACGTTACTGTAGTATGAAGCAGAGCAGGACCGAGTGTTGTGGGAGCTGAACGAGGCCACTGGAGCGATTGCGCAACACACGCCTCACAAGCAGCGTAACTTTTATTATGCCACAGTCGCCGGCGCCGCTTCCACTTTTCTGGTCATGAGTATGAGGTAACGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU259078 True 207 lncRNA 0.51 1 5430357 5430563

Neighbor

gene id symbol gene type direction distance location
CI01000053_05362044_05364177 PBLD2, PBLD coding upstream 64660 5360922 ~ 5365697 (+)
CI01000053_05338500_05348218 HNF1A coding upstream 82139 5338500 ~ 5348218 (+)
CI01000053_05332254_05334016 NA coding upstream 96037 5332254 ~ 5334320 (+)
CI01000053_05320241_05329853 HPS4 coding upstream 100493 5320241 ~ 5329864 (+)
CI01000053_05314523_05315601 NA coding upstream 113767 5314523 ~ 5316590 (+)
CI01000053_05435608_05443587 GGT5A coding downstream 4916 5435479 ~ 5445226 (+)
CI01000053_05471449_05512831 LRRC75B coding downstream 40886 5471449 ~ 5513074 (+)
CI01000053_05526931_05550454 NA coding downstream 96066 5526629 ~ 5550472 (+)
CI01000053_05563771_05573792 RNF34, RNF34A coding downstream 133208 5563771 ~ 5573965 (+)
CI01000053_05589379_05590208 NA coding downstream 158329 5588892 ~ 5591102 (+)
G228309 NA non-coding upstream 17074 5412569 ~ 5413283 (+)
G228311 NA non-coding upstream 18017 5411959 ~ 5412340 (+)
G228274 NA non-coding upstream 168987 5261031 ~ 5261370 (+)
G228263 NA non-coding upstream 231789 5198356 ~ 5198568 (+)
G228243 NA non-coding upstream 273576 5156422 ~ 5156781 (+)
G228334 NA non-coding downstream 93017 5523580 ~ 5524211 (+)
G228374 NA non-coding downstream 111695 5542258 ~ 5542539 (+)
G228337 NA non-coding downstream 121436 5551999 ~ 5552423 (+)
G228257 NA other upstream 51908 5375553 ~ 5378449 (+)
G227317 NA other upstream 1014764 4414951 ~ 4415593 (+)
G226399 NA other upstream 1732828 3620798 ~ 3697529 (+)
G226347 NA other upstream 2155446 3272374 ~ 3274911 (+)
G226292 NA other upstream 2383574 3036602 ~ 3046783 (+)
CI01000053_06725452_06758944 NA other downstream 1292636 6725452 ~ 6758944 (+)

Expression


Co-expression Network