G228589


Basic Information

Item Value
gene id G228589
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 5602811 ~ 5603113 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU259411
ATTTTTTTCAACAACGCTGTTGGACATTGTTGATATTTGAAATCAACCCAAACAAACCCACCCCTCTCTTCATTGCTCCGCCTCCAAAACTCACCCTTCAATCCTAACCACCCTGCTCCAAGTCGGTCTCGAACCGGGACCCAATAGACCCTTTTCACATTTCCTGGGTTTCTCAGAAGCGGAAGTCGTCATAGTTGGGTAAACTTTTATAGTGGTGAATGAGAGACTTCATTAAATATATTTTTCGTGTTTCCATTTGAGCAAATAGCAAAAGAAAAAGTTTTTGTTTTTGCTTTAGTCAGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU259411 True 303 lncRNA 0.40 1 5602811 5603113

Neighbor

gene id symbol gene type direction distance location
CI01000053_05577140_05583728 KDM2B, KDM2BA coding downstream 18046 5577046 ~ 5584765 (-)
CI01000053_05552919_05561938 ANAPC5 coding downstream 39850 5552169 ~ 5562961 (-)
CI01000053_05521820_05524159 GPX8 coding downstream 78652 5521615 ~ 5524159 (-)
CI01000053_05452721_05459354 GGT1A, GGT1B, GGT1 coding downstream 143457 5452264 ~ 5459354 (-)
CI01000053_05416830_05423957 ASPHD2 coding downstream 178114 5415744 ~ 5424697 (-)
CI01000053_05621226_05622308 APJA, APLNRA, APLNR coding upstream 17296 5620409 ~ 5622498 (-)
CI01000053_05675892_05686424 NA coding upstream 71866 5674979 ~ 5686424 (-)
CI01000053_05690377_05690558 NA coding upstream 87264 5690377 ~ 5690777 (-)
CI01000053_05692640_05695728 MYL7, MYLC2A, MYL7.L coding upstream 89522 5692635 ~ 5695728 (-)
CI01000053_05732296_05750809 NPC1L1 coding upstream 128265 5731378 ~ 5750809 (-)
G228586 NA non-coding downstream 56432 5546145 ~ 5546379 (-)
G228585 NA non-coding downstream 60155 5542425 ~ 5542656 (-)
G228584 NA non-coding downstream 64987 5537605 ~ 5537824 (-)
G228583 NA non-coding downstream 69289 5533210 ~ 5533522 (-)
G228592 NA non-coding upstream 1636 5604749 ~ 5605034 (-)
G228593 NA non-coding upstream 2038 5605151 ~ 5605392 (-)
G228595 NA non-coding upstream 6184 5609297 ~ 5609705 (-)
G228608 NA non-coding upstream 40492 5643605 ~ 5643862 (-)
G228610 NA non-coding upstream 45920 5649033 ~ 5649250 (-)
G227604 NA other downstream 1515071 4087237 ~ 4087740 (-)
CI01000053_03551506_03551965 NA other downstream 2049840 3550333 ~ 3552847 (-)
G226963 NA other downstream 2605543 2996717 ~ 2997268 (-)
G226826 NA other downstream 3035739 2565892 ~ 2567072 (-)
CI01000053_02225226_02226481 YPELD, YPEL2B, YPEL1, YPELC, YPEL2 other downstream 3365415 2225210 ~ 2226481 (-)
G228651 NA other upstream 181370 5784483 ~ 5787690 (-)
G228750 NA other upstream 328479 5931592 ~ 5932241 (-)

Expression


Co-expression Network