G228619


Basic Information

Item Value
gene id G228619
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 5662954 ~ 5663162 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU259441
ATCAACCAGCAGATCTCCGAGGCTAACTCCGCCGAATCCGCTCCGCTGGGAGGTCCTGAGGGGCTTCTCTACGTTCCCCCGGCACATCCTCAGCCCCTCATGGACTTAGCTCACTCCTCTCCAGGCTCTGGACACCCAGGTAGTTCACGTACCCTCTCGCTTCTGCAGCAACAGTACTGGTGGCCATCCATGCCCCAGGATGTCTCCCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU259441 True 209 lncRNA 0.61 1 5662954 5663162

Neighbor

gene id symbol gene type direction distance location
CI01000053_05621226_05622308 APJA, APLNRA, APLNR coding downstream 40456 5620409 ~ 5622498 (-)
CI01000053_05577140_05583728 KDM2B, KDM2BA coding downstream 78189 5577046 ~ 5584765 (-)
CI01000053_05552919_05561938 ANAPC5 coding downstream 99993 5552169 ~ 5562961 (-)
CI01000053_05521820_05524159 GPX8 coding downstream 138795 5521615 ~ 5524159 (-)
CI01000053_05452721_05459354 GGT1A, GGT1B, GGT1 coding downstream 203600 5452264 ~ 5459354 (-)
CI01000053_05675892_05686424 NA coding upstream 11817 5674979 ~ 5686424 (-)
CI01000053_05690377_05690558 NA coding upstream 27215 5690377 ~ 5690777 (-)
CI01000053_05692640_05695728 MYL7, MYLC2A, MYL7.L coding upstream 29473 5692635 ~ 5695728 (-)
CI01000053_05732296_05750809 NPC1L1 coding upstream 68216 5731378 ~ 5750809 (-)
CI01000053_06038638_06043939 FAHD2B, FAHD2A coding upstream 375174 6038336 ~ 6043939 (-)
G228610 NA non-coding downstream 13704 5649033 ~ 5649250 (-)
G228608 NA non-coding downstream 19092 5643605 ~ 5643862 (-)
G228595 NA non-coding downstream 53249 5609297 ~ 5609705 (-)
G228593 NA non-coding downstream 57562 5605151 ~ 5605392 (-)
G228592 NA non-coding downstream 57920 5604749 ~ 5605034 (-)
G228620 NA non-coding upstream 337 5663499 ~ 5663732 (-)
G228622 NA non-coding upstream 3241 5666403 ~ 5666761 (-)
G228639 NA non-coding upstream 94092 5757254 ~ 5757596 (-)
G228641 NA non-coding upstream 99137 5762299 ~ 5762553 (-)
G228651 NA non-coding upstream 121321 5784483 ~ 5787690 (-)
G227604 NA other downstream 1575214 4087237 ~ 4087740 (-)
CI01000053_03551506_03551965 NA other downstream 2109983 3550333 ~ 3552847 (-)
G226963 NA other downstream 2665686 2996717 ~ 2997268 (-)
G226826 NA other downstream 3095882 2565892 ~ 2567072 (-)
CI01000053_02225226_02226481 YPELD, YPEL2B, YPEL1, YPELC, YPEL2 other downstream 3425558 2225210 ~ 2226481 (-)
G228750 NA other upstream 268430 5931592 ~ 5932241 (-)

Expression


Co-expression Network