G228740



Basic Information


Item Value
gene id G228740
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000053
NCBI id null
chromosome length 7014373
location 5919350 ~ 5919774 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU259573
GACAAGTCATTTCACTCGGCGGCCATCTTTGAAACGCCTCTCGGGCATCCTGGGCATCATGCAGCTCCTATCTCTTTGAATGGGGAAACATCAAATTCTCCAAAGCTGTTTGCCAAGCTTTCGATTAAATTTCATATTTGAAATCACCAATGAAATCTGACAACAACTGTCTCATAATTTTTTTTTTCCAAATGCTCAAATCATGACAAAAAAAAACAGTATTTAGGCTGGAACAGGCTAATGCGCATGCGCAGACCTAAATGCGCGTCTCTTGTGCCTCATTTCGGAGGCGCACGTCTGACTGTTTCTATAGAAACCGGTGCTTCTAACGGCCGCTGCAGTGACGCGATGACTTTACAGGTCGGCGATTGGCTCTTATTTTGAAGGTGGTACTTATTCCGCCATATTGAGCATTACACTTTCTC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU259573 True 425 lncRNA 0.44 1 5919350 5919774

Neighbor


gene id symbol gene type direction distance location
CI01000053_05732296_05750809 NPC1L1 coding downstream 168541 5731378 ~ 5750809 (-)
CI01000053_05692640_05695728 MYL7, MYLC2A, MYL7.L coding downstream 223622 5692635 ~ 5695728 (-)
CI01000053_05690377_05690558 NA coding downstream 228573 5690377 ~ 5690777 (-)
CI01000053_05675892_05686424 NA coding downstream 232926 5674979 ~ 5686424 (-)
CI01000053_05621226_05622308 APJA, APLNRA, APLNR coding downstream 296852 5620409 ~ 5622498 (-)
CI01000053_06038638_06043939 FAHD2B, FAHD2A coding upstream 118562 6038336 ~ 6043939 (-)
CI01000053_06060129_06071679 RNF10 coding upstream 139835 6059609 ~ 6071679 (-)
CI01000053_06162569_06179766 GOLGA1 coding upstream 242305 6162079 ~ 6180102 (-)
CI01000053_06287804_06296687 NA coding upstream 367440 6287214 ~ 6296687 (-)
CI01000053_06308157_06310323 NA coding upstream 387828 6307318 ~ 6310466 (-)
G228718 NA non-coding downstream 35472 5883618 ~ 5883878 (-)
G228700 NA non-coding downstream 79248 5839847 ~ 5840102 (-)
G228691 NA non-coding downstream 95547 5823486 ~ 5823803 (-)
G228689 NA non-coding downstream 96536 5822495 ~ 5822814 (-)
G228668 NA non-coding downstream 116100 5802990 ~ 5803250 (-)
G229167 NA non-coding upstream 94164 6013938 ~ 6015808 (-)
G229198 NA non-coding upstream 208662 6128436 ~ 6128750 (-)
G229203 NA non-coding upstream 214169 6133943 ~ 6138966 (-)
G229212 NA non-coding upstream 233016 6152790 ~ 6153763 (-)
G229207 NA non-coding upstream 272867 6192641 ~ 6221224 (-)
G228651 NA other downstream 131660 5784483 ~ 5787690 (-)
G227604 NA other downstream 1831610 4087237 ~ 4087740 (-)
CI01000053_03551506_03551965 NA other downstream 2366379 3550333 ~ 3552847 (-)
G226963 NA other downstream 2922082 2996717 ~ 2997268 (-)
G226826 NA other downstream 3352278 2565892 ~ 2567072 (-)
G228750 NA other upstream 11818 5931592 ~ 5932241 (-)

Expression



Co-expression Network