XLOC_009854 (mir196d)


Basic Information

Item Value
gene id XLOC_009854
gene name mir196d
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information

Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 20913413 ~ 20913484 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence

>TCONS_00019667
AGTGATTTAGGTAGTTTTATGTTGTTGGGCTCTATTTTATATCCCCGCAACACGAAACTGTCTTAATTGCCT

Function

symbol description
mir196d Predicted to enable translation repressor activity, mRNA regulatory element binding. Predicted to act upstream of or within mRNA cleavage involved in gene silencing by miRNA and miRNA mediated inhibition of translation. Is expressed in neural tube; pectoral fin; and tail bud. Orthologous to human MIR196B (microRNA 196b).

GO:

id name namespace
GO:0035278 miRNA mediated inhibition of translation biological_process
GO:0035279 mRNA cleavage involved in gene silencing by miRNA biological_process
GO:0005575 cellular_component cellular_component
GO:0000900 translation repressor activity, mRNA regulatory element binding molecular_function

KEGG: NA

ZFIN:

id description
ZDB-MIRNAG-050712-2 Predicted to enable translation repressor activity, mRNA regulatory element binding. Predicted to act upstream of or within mRNA cleavage involved in gene silencing by miRNA and miRNA mediated inhibition of translation. Is expressed in neural tube; pectoral fin; and tail bud. Orthologous to human MIR196B (microRNA 196b).

Ensembl:

ensembl_id ENSDARG00000081098

RNA

RNA id representative length rna type GC content exon number start site end site
TCONS_00019667 True 72 miRNA 0.38 1 20913413 20913484

Neighbor

gene id symbol gene type direction distance location
XLOC_009853 hoxa10b coding upstream 410 20910186 ~ 20913003 (+)
XLOC_009852 hoxa11b coding upstream 6035 20904754 ~ 20907378 (+)
XLOC_009851 hoxa13b coding upstream 15577 20895904 ~ 20897836 (+)
XLOC_009850 hibadhb coding upstream 23897 20871015 ~ 20889516 (+)
XLOC_009849 jazf1b coding upstream 112915 20738740 ~ 20800498 (+)
XLOC_009855 hoxa9b coding downstream 1835 20915319 ~ 20917584 (+)
XLOC_009856 hoxa2b coding downstream 13189 20926673 ~ 20929183 (+)
XLOC_009857 skap2 coding downstream 20869 20934353 ~ 20977706 (+)
XLOC_009858 BX571678.1 coding downstream 103336 21016820 ~ 21055136 (+)
XLOC_009859 NA coding downstream 227564 21141048 ~ 21142516 (+)
XLOC_009848 NA non-coding upstream 217896 20684940 ~ 20695517 (+)
XLOC_009847 NA non-coding upstream 381641 20530125 ~ 20531772 (+)
XLOC_009840 CU855688.1 non-coding upstream 1104296 19805021 ~ 19809117 (+)
XLOC_009837 BX005389.4 non-coding upstream 1198203 19686713 ~ 19715210 (+)
XLOC_009862 NA non-coding downstream 720903 21634387 ~ 21634836 (+)
XLOC_009866 NA non-coding downstream 960911 21874395 ~ 21877421 (+)
XLOC_009868 NA non-coding downstream 1108807 22022291 ~ 22113936 (+)
XLOC_009869 NA non-coding downstream 1410282 22323766 ~ 22327502 (+)
XLOC_009838 BX005389.1 non-coding upstream 1208875 19704424 ~ 19704538 (+)

Expression


Co-expression Network