XLOC_009862



Basic Information


Item Value
gene id XLOC_009862
gene name NA
gene type non-coding
species zebrafish (Danio rerio)
category of species model fish

Chromosome Information


Item Value
chromosome id NC_007127.7
NCBI id CM002900.2
chromosome length 55266484
location 21634387 ~ 21634836 (+)
genome version GRCz11_2017_zebrafish_Genome

Sequence


>TCONS_00021922
GTCAGCTCACATACAGCAGTAGGACAGACGCTTTGATTTTGCTTCATTGATTTCTTGGATTTAAAGGCTGATCGGCTTCTGCATAATCAGTCTTTAGCCAGGAATGGATGGCAGAAAAGAAATGAAAGTCACTGGAAAAGAGGCCGAGCTTCAGTGTGATGAGTTCAAACAGGTAAGATCTCCTTGGAAGATGAAAGCAGA

Function


GO: NA

KEGG:

id description
ko03230 Viral genome structure
ko05164 Influenza A
ko03200 Viral proteins

RNA


RNA id representative length rna type GC content exon number start site end site
TCONS_00021922 True 201 lncRNA 0.43 2 21634387 21634836
Loading

Neighbor


gene id symbol gene type direction distance location
XLOC_009861 gsdmeb coding upstream 193161 21425114 ~ 21441226 (+)
XLOC_009860 osbpl3b coding upstream 215612 21242491 ~ 21418775 (+)
XLOC_009859 NA coding upstream 491871 21141048 ~ 21142516 (+)
XLOC_009858 BX571678.1 coding upstream 579251 21016820 ~ 21055136 (+)
XLOC_009857 skap2 coding upstream 656681 20934353 ~ 20977706 (+)
XLOC_009863 si:ch211-154o6.3 coding downstream 64144 21698980 ~ 21745336 (+)
XLOC_009864 trim108 coding downstream 154867 21789703 ~ 21805974 (+)
XLOC_009865 zmp:0000000608 coding downstream 232325 21867161 ~ 21867872 (+)
XLOC_009866 NA coding downstream 239559 21874395 ~ 21877421 (+)
XLOC_009867 znf687a coding downstream 282837 21917673 ~ 21938044 (+)
XLOC_009854 mir196d non-coding upstream 720903 20913413 ~ 20913484 (+)
XLOC_009848 NA non-coding upstream 938870 20684940 ~ 20695517 (+)
XLOC_009847 NA non-coding upstream 1102615 20530125 ~ 20531772 (+)
XLOC_009840 CU855688.1 non-coding upstream 1825270 19805021 ~ 19809117 (+)
XLOC_009868 NA non-coding downstream 387455 22022291 ~ 22113936 (+)
XLOC_009869 NA non-coding downstream 688930 22323766 ~ 22327502 (+)
XLOC_009870 NA non-coding downstream 693134 22327970 ~ 22329028 (+)
XLOC_009872 NA non-coding downstream 940307 22575143 ~ 22579326 (+)

Expression


Expression of XLOC_009862 in the Zebrafish Sample from each Developmental Stage of PRJEB12982

Boxplot with 18 boxes. Box plot charts are typically used to display groups of statistical data. Each data point in the chart can have up to 5 values: minimum, lower quartile, median, upper quartile, and maximum.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Expression of XLOC_009862 in the Zebrafish Sample of PRJEB12982

Bar chart with 360 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 40.
End of interactive chart.

Co-expression Network