CI01000054_05822181_05823458 (ZN706, ZNF706, ZFP706)


Basic Information

Item Value
gene id CI01000054_05822181_05823458
gene name ZN706, ZNF706, ZFP706
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 5822146 ~ 5823684 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000054_05822181_05823458.mRNA
AGATACAAATGTGATTATATGTCGTTTTAGGCATTTAAAGGGATAATTCGCCCTAAAATGAAAATTCTTTAATCGTTTACTCGGCTACATGTTGTTTCAAACCTGTATGGCTTTCCTCCGTCTCATTCACTTTCTTTGTATGGAAGGAAAAGTGACTGATATGTCAGCATTATATCTGTCTACTTGAGCGAGTCATTATATATAATGTTTGTTTTCAGAGAAGGCCATGGCTCGTGGGCAACAGAAGATCCAGTCTCAACAGAAGAACGCAAAGAAAGCAGCTGAGAAGAAGAAATCTCAAGGAGCGGATCAGAAGACTGCCGCCAAAGCAGCACTGGTCCACACCTGTCCTGTCTGCAGGACGCAGATGCCAGATCCCAAGACGTTTAAACAGCATTTTGAAAGCAAACACCCAAAGTCTCCTATGCCTCCTGAGCTGGTGGATGTTCAAGCCTAAAGGACACAATAAA

Function

symbol description
znf706 Orthologous to human ZNF706 (zinc finger protein 706).
zfp706 Predicted to be involved in negative regulation of stem cell population maintenance and negative regulation of transcription, DNA-templated. Predicted to be located in cytoplasm and nucleus. Orthologous to human ZNF706 (zinc finger protein 706).

GO:

id name namespace
GO:0005737 cytoplasm cellular_component

KEGG: NA

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000054_05822181_05823458.mRNA False 470 mRNA 0.42 2 5822168 5823684

Neighbor

gene id symbol gene type direction distance location
CI01000054_05711250_05711861 NA coding downstream 109529 5710622 ~ 5712639 (-)
CI01000054_05685529_05686880 NA coding downstream 134754 5685500 ~ 5687414 (-)
CI01000054_05341497_05372926 ANGPT2B coding downstream 449242 5341110 ~ 5372926 (-)
CI01000054_05292456_05317677 NA coding downstream 503177 5292299 ~ 5318991 (-)
CI01000054_04671351_04681181 PEF1 coding downstream 1140807 4670151 ~ 4681361 (-)
CI01000054_05827691_05828736 WDYHV1 coding upstream 3709 5827393 ~ 5830717 (-)
CI01000054_05853193_05858118 WISP1A coding upstream 29391 5853075 ~ 5858118 (-)
CI01000054_05956278_05957354 FAM206A coding upstream 132429 5956113 ~ 5957354 (-)
CI01000054_05990266_06191955 GABBR2 coding upstream 166582 5990266 ~ 6191955 (-)
CI01000054_06210877_06211356 NA coding upstream 387123 6210807 ~ 6211475 (-)
G233420 NA non-coding downstream 70890 5750346 ~ 5751278 (-)
G233356 NA non-coding downstream 347776 5474145 ~ 5474392 (-)
G232439 NA non-coding downstream 407626 5414224 ~ 5414542 (-)
G232437 NA non-coding downstream 410053 5411567 ~ 5412115 (-)
G232432 NA non-coding downstream 412846 5404061 ~ 5409322 (-)
CI01000054_06283619_06286512 NA non-coding upstream 456860 6280544 ~ 6286767 (-)
G233539 NA non-coding upstream 493637 6317321 ~ 6325541 (-)
G233581 NA non-coding upstream 589399 6413083 ~ 6413708 (-)
G233585 NA non-coding upstream 594921 6418605 ~ 6418858 (-)
G233590 NA non-coding upstream 599097 6422781 ~ 6423081 (-)
G232274 NA other downstream 612928 5206199 ~ 5209240 (-)
G231645 NA other downstream 1839345 3981847 ~ 3982823 (-)
G230908 NA other downstream 2758825 3057648 ~ 3063343 (-)
CI01000054_02857402_02860451 NA other downstream 2961595 2857402 ~ 2860573 (-)
CI01000054_06629482_06641861 TRIQK other upstream 804398 6628082 ~ 6642160 (-)
CI01000054_07165957_07169539 HEYL other upstream 1341751 7165435 ~ 7169539 (-)
G235216 NA other upstream 3424355 9248039 ~ 9248538 (-)
CI01000054_09483912_09484282 MRPL36 other upstream 3659463 9483147 ~ 9484282 (-)
CI01000054_09864693_09866871 PPP1R11 other upstream 4039637 9863321 ~ 9867212 (-)

Expression


Co-expression Network