CI01000054_08325126_08329621 (HPCAL4, VSNL1, VSNL1.S)


Basic Information

Item Value
gene id CI01000054_08325126_08329621
gene name HPCAL4, VSNL1, VSNL1.S
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 8325126 ~ 8329716 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000054_08325126_08329621.mRNA
GATATTATTACATCTGTGGCAAAAAACTTATTGCTGTTACAACTCCCAGAGAGGTGTAAAAAGATGGGGAAACACAACAGCAAGCTTGCTCCTGAGGTGCTAGATGACTTGACCAAGAGTACAGAGTTCAATGAAGCTGAGCTGAAGCAGTGGTATAAGGGATTTCTGAAGGACTGTCCAACTGGCATCCTCAATCTGGAAGAGTTCCAGCAACTCTATGTCAAGTTCTTCCCTTATGGCGATGCTTCAAAATTCGCTCAGCATGCCTTTCGGACATTTGACAAAAACGGTGATGGTACCATTGACTTCAGGGAGTTTATCTGCGCACTATCCATCACTTCCAGGGGAAGTTTTGAGCAGAAACTCAACTGGGCCTTCAACATGTATGACCTGGACGGAGATGGCAAGATCACACGCATGGAGATGCTGGAGATCATTGAGGCAATCTACAAGATGGTTGGAACGGTGATCATGATGCGTATGAACGAGGACGGGCTGACCCCACAGCAGCGCGTGGACAAAATCTTCAGCAAGATGGACAAAGACCACAACGATGAGATCACGCTGGAAGAGTTCAAAGAGGCGGCCAAGAGTGACCCCTCCATTGTTCTTTTACTGCAATGTGACATGCAGAAGTAAGGAAGGAGAGGAGGAAGATGAGTGAAGGGGGCTGGGGGTGTAGGGAGGGGAGGAGAACCATGTACAGACTTCTTGAGAGATGTAGGTAATAGATG

Function

symbol description
hpcal4 Predicted to enable calcium ion binding activity. Orthologous to human HPCAL4 (hippocalcin like 4).
vsnl1 Predicted to enable calcium ion binding activity. Predicted to act upstream of or within negative regulation of insulin secretion; positive regulation of exocytosis; and positive regulation of insulin secretion involved in cellular response to glucose stimulus. Predicted to be located in cytosol and membrane.

GO:

id name namespace
GO:0035774 positive regulation of insulin secretion involved in cellular response to glucose stimulus biological_process

KEGG:

id description
K19936 VSNL1; visinin-like protein 1

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000054_08325126_08329621.mRNA False 734 mRNA 0.47 4 8325126 8329716

Neighbor

gene id symbol gene type direction distance location
CI01000054_08252231_08263823 NA coding upstream 61174 8252052 ~ 8263952 (+)
CI01000054_08243772_08246444 NA coding upstream 78396 8243772 ~ 8246730 (+)
CI01000054_08196671_08203451 NA coding upstream 121275 8196504 ~ 8203851 (+)
CI01000054_08174433_08193026 TRIT1 coding upstream 132100 8174433 ~ 8193026 (+)
CI01000054_08155292_08167525 NA coding upstream 157346 8155292 ~ 8167780 (+)
CI01000054_08336243_08350281 BAG6L coding downstream 6527 8336243 ~ 8350914 (+)
CI01000054_08362528_08374374 ABCF1 coding downstream 32812 8362528 ~ 8374961 (+)
CI01000054_08377415_08378038 NA coding downstream 47409 8377125 ~ 8378689 (+)
CI01000054_08378811_08396034 PPP1R10 coding downstream 48999 8378715 ~ 8396222 (+)
CI01000054_08419492_08424760 KHDRBS1 coding downstream 88903 8418619 ~ 8424921 (+)
G233305 NA non-coding upstream 20678 8304082 ~ 8304448 (+)
G233297 NA non-coding upstream 33317 8291607 ~ 8291809 (+)
G233262 NA non-coding upstream 40573 8284276 ~ 8284553 (+)
G233254 NA non-coding upstream 59608 8264318 ~ 8265518 (+)
G233233 NA non-coding upstream 203426 8121096 ~ 8121700 (+)
G233322 NA non-coding downstream 164528 8494244 ~ 8494479 (+)
G233335 NA non-coding downstream 192002 8521718 ~ 8522154 (+)
G233337 NA non-coding downstream 197118 8526834 ~ 8527577 (+)
G233338 NA non-coding downstream 198161 8527877 ~ 8528174 (+)
G234433 NA non-coding downstream 231881 8561597 ~ 8561807 (+)
G233306 NA other upstream 20177 8304599 ~ 8304949 (+)
G233024 NA other upstream 715233 7567523 ~ 7609893 (+)
G232870 NA other upstream 1436623 6887912 ~ 6888503 (+)
G232659 NA other upstream 1949232 6374850 ~ 6375894 (+)
CI01000054_06305908_06312122 NA other upstream 2018266 6305908 ~ 6312163 (+)
G235560 NA other downstream 2058420 10388136 ~ 10392378 (+)
CI01000054_11564820_11568338 S100V2 other downstream 3235260 11564820 ~ 11568999 (+)
CI01000054_11633235_11635069 PRF1.8 other downstream 3303260 11632959 ~ 11635103 (+)
CI01000054_11648262_11648786 NA other downstream 3318263 11647959 ~ 11649495 (+)
G236874 NA other downstream 3483972 11813688 ~ 11816475 (+)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
bowfin (Amia calva) AMCG00011045 hpcal4,LOC107691524,LOC107091490,LOC102228321,LOC107562761 coding CM030133.1 CM030133.1 8804751 ~ 8806377 (+)