CI01000054_09483912_09484282 (MRPL36)


Basic Information

Item Value
gene id CI01000054_09483912_09484282
gene name MRPL36
gene type misc
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 9483147 ~ 9484282 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000054_09483912_09484282.mRNA
GTGTTGACACCATGGCACCACTGTTGCTCCCTTGTCTTTTTGGTTCCTTGACTCGGCAGTTGTCCCAAGTTGCCAGATGTGCTGCTTTCGGCTCCTTACCTGCAGTAGGTGCACAGAGATGTATCTCCACCATCACAGCTGCAACCATGCAATTTAGGAGATTCGTCAACCCAATGTGCAAGCCTCACGCGGCTTTCCTCTCACCCCTGCTTGGACAGTGCCAGCAGCTCCTGTGTGTTCAGCCATCTGCTGGCATGAAGACAAAAACAGCTCTTAAAAGACGCTGTAAAGACTGCTTTTTCGTCCGCCGTCGTGGAAGGTTGTTTGTTTTTTGCAAATCTCACCCCAGACACAAGCAGCGGCAGGGGTGAATTAATTGAGACCTCAATGTGTGTTTTCAAATGAGGACTTGAGAATCACTTGTCTTGATCGGTGTATTGAGCATGTAAAGATCATAGAGTTTCTAATAAA

Function

symbol description
mrpl36 Predicted to be a structural constituent of ribosome. Predicted to be involved in ribosome biogenesis. Predicted to act upstream of or within translation. Predicted to be located in mitochondrion and ribosome. Predicted to be part of mitochondrial large ribosomal subunit. Orthologous to human MRPL36 (mitochondrial ribosomal protein L36).

GO:

id name namespace
GO:0005840 ribosome cellular_component

KEGG:

id description
K02919 RP-L36, MRPL36, rpmJ; large subunit ribosomal protein L36

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000054_09483912_09484282.mRNA False 471 mRNA 0.48 1 9483812 9484282

Neighbor

gene id symbol gene type direction distance location
CI01000054_09453616_09482480 LPCAT1 coding downstream 1089 9452109 ~ 9482723 (-)
CI01000054_09218869_09223868 NA coding downstream 259693 9218632 ~ 9224119 (-)
CI01000054_09077309_09080163 NA coding downstream 403000 9076831 ~ 9080812 (-)
CI01000054_08953766_08966617 TMEM57, TMEM57A coding downstream 517195 8952134 ~ 8966617 (-)
CI01000054_08937312_08942587 LDLRAP1, LDLRAP1A coding downstream 541225 8937312 ~ 8942587 (-)
CI01000054_09488559_09488870 NA coding upstream 3994 9488276 ~ 9488870 (-)
CI01000054_09495785_09497239 IRX4B, IRX4 coding upstream 11168 9495450 ~ 9497682 (-)
CI01000054_09531778_09544007 NA coding upstream 47228 9531510 ~ 9544510 (-)
CI01000054_09650064_09651286 MED10, MED10.S coding upstream 165525 9649807 ~ 9651286 (-)
CI01000054_09686420_09705911 NSUN2.S, NSUN2 coding upstream 201765 9686047 ~ 9705911 (-)
G235308 NA non-coding downstream 41961 9437469 ~ 9441851 (-)
G235298 NA non-coding downstream 83246 9400361 ~ 9400566 (-)
G235250 NA non-coding downstream 167014 9316532 ~ 9316798 (-)
G235244 NA non-coding downstream 181108 9302438 ~ 9302704 (-)
G235239 NA non-coding downstream 190420 9292830 ~ 9293392 (-)
G235350 NA non-coding upstream 42566 9526848 ~ 9527267 (-)
G235368 NA non-coding upstream 72482 9556764 ~ 9559903 (-)
G235575 NA non-coding upstream 92312 9576594 ~ 9576876 (-)
G235582 NA non-coding upstream 98140 9582422 ~ 9664231 (-)
G235591 NA non-coding upstream 103777 9588059 ~ 9657253 (-)
G235216 NA other downstream 235274 9248039 ~ 9248538 (-)
CI01000054_07165957_07169539 HEYL other downstream 2312139 7165435 ~ 7169539 (-)
CI01000054_06629482_06641861 TRIQK other downstream 2829799 6628082 ~ 6642160 (-)
G232274 NA other downstream 4274572 5206199 ~ 5209240 (-)
CI01000054_04671351_04681181 PEF1 other downstream 4811579 4670151 ~ 4681361 (-)
CI01000054_09864693_09866871 PPP1R11 other upstream 379039 9863321 ~ 9867212 (-)
CI01000054_10817235_10819181 TAC1 other upstream 1319589 10816015 ~ 10819362 (-)
CI01000054_10872970_10881017 SDHAF3 other upstream 1386822 10871104 ~ 10881495 (-)
G236748 NA other upstream 1800912 11285194 ~ 11295784 (-)
CI01000054_11780397_11781842 SNAPIN other upstream 2294608 11778890 ~ 11781880 (-)

Expression


Co-expression Network