G229637


Basic Information

Item Value
gene id G229637
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 97764 ~ 98022 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU260589
GCTCAATTCAACGCTGGATTTGCACAAAAGATTAACATGACGGCACATGCTAGTCGATGAGTTGAATCAACTCCACAGCAACTACATAAATTTATCCACTAACCATTCAGAAACGTCCAGTTTCATTCTAAAAGTTGTAACTTCTTCCTGAGTCTCTCCATCAGTGTCTGACTCCGGTTTGAACAATGTAAGGCTGAACACCGTTACTGACAATCCTCATTTTGGCTGCGTGAGATTCTCCAGCTTTGTTGTTGTTGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU260589 True 259 lncRNA 0.42 1 97764 98022

Neighbor

gene id symbol gene type direction distance location
CI01000054_00131576_00136719 NA coding downstream 32807 130829 ~ 136846 (+)
CI01000054_00157332_00178926 NA coding downstream 59310 157332 ~ 180145 (+)
CI01000054_00239444_00241646 NA coding downstream 141422 239444 ~ 241843 (+)
CI01000054_00248538_00251489 NA coding downstream 149971 247993 ~ 252114 (+)
CI01000054_00390853_00579795 CSMD3 coding downstream 292831 390853 ~ 579795 (+)
G229630 NA non-coding upstream 9382 88152 ~ 88382 (+)
G229638 NA non-coding downstream 86852 184874 ~ 187028 (+)
G229670 NA non-coding downstream 204833 302855 ~ 348887 (+)
G229682 NA non-coding downstream 273608 371630 ~ 371932 (+)
G229717 NA non-coding downstream 762578 860600 ~ 861220 (+)
CI01000054_00916253_00919736 NA non-coding downstream 818094 916116 ~ 919986 (+)
CI01000054_01227110_01229796 EEF1A1L1 other downstream 1128313 1226335 ~ 1230329 (+)
G229760 NA other downstream 1168328 1266350 ~ 1273750 (+)
G229936 NA other downstream 1299058 1397080 ~ 1407130 (+)
CI01000054_01578022_01579167 NA other downstream 1480413 1578022 ~ 1579356 (+)
CI01000054_01650242_01665628 PLEKHO1A other downstream 1552938 1650242 ~ 1666115 (+)

Expression


Co-expression Network