G229865


Basic Information

Item Value
gene id G229865
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 1013175 ~ 1013401 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU260854
GGAAGTGGTCGAAAGCGGACAAGCTCAAAATGTTTTACACGTCGTTTACTTCTGTATTTAGTGTCGTCCACTTGTGATCCGATCGACCAAAATGCATCTTAATACCAGGTGTAAACAGGGCCTTTGACGCATCCAGCCTTCGAAGGATGCAGCCTCTGAATTGGGACATGGCTAATGTGAACAGACCAACAGGAGAAGGGGGAAGCTATCAAAGTGTGAAAGCAGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU260854 True 227 lncRNA 0.47 1 1013175 1013401

Neighbor

gene id symbol gene type direction distance location
CI01000054_00992036_01004247 NA coding upstream 8783 992036 ~ 1004392 (+)
CI01000054_00916253_00919736 NA coding upstream 93189 916116 ~ 919986 (+)
CI01000054_00885259_00886020 NA coding upstream 127155 885259 ~ 886020 (+)
CI01000054_00879731_00882536 MTERF3 coding upstream 130578 879731 ~ 882597 (+)
CI01000054_00869317_00877277 RAD21B, RAD21 coding upstream 135046 867126 ~ 878129 (+)
CI01000054_01042925_01056338 NA coding downstream 29490 1042891 ~ 1056561 (+)
CI01000054_01087465_01101501 AHDC1, METTL24 coding downstream 73531 1086932 ~ 1101774 (+)
CI01000054_01103702_01106852 NA coding downstream 90040 1103441 ~ 1106852 (+)
CI01000054_01122882_01126143 NA coding downstream 109481 1122882 ~ 1126784 (+)
CI01000054_01133011_01143370 NA coding downstream 119610 1133011 ~ 1143612 (+)
G229864 NA non-coding upstream 2047 1010721 ~ 1011128 (+)
G229849 NA non-coding upstream 28022 983600 ~ 985153 (+)
G229848 NA non-coding upstream 31263 978703 ~ 981912 (+)
G229847 NA non-coding upstream 36215 970579 ~ 976960 (+)
G229736 NA non-coding upstream 94901 917989 ~ 918274 (+)
G229872 NA non-coding downstream 44607 1058008 ~ 1059151 (+)
G229883 NA non-coding downstream 108691 1122092 ~ 1122351 (+)
G229806 NA non-coding downstream 130732 1144133 ~ 1144557 (+)
G229770 NA non-coding downstream 132889 1146290 ~ 1151146 (+)
G229831 NA non-coding downstream 147801 1161202 ~ 1161520 (+)
CI01000054_01227110_01229796 EEF1A1L1 other downstream 212934 1226335 ~ 1230329 (+)
G229760 NA other downstream 252949 1266350 ~ 1273750 (+)
G229936 NA other downstream 383679 1397080 ~ 1407130 (+)
CI01000054_01578022_01579167 NA other downstream 565034 1578022 ~ 1579356 (+)
CI01000054_01650242_01665628 PLEKHO1A other downstream 637559 1650242 ~ 1666115 (+)

Expression


Co-expression Network