G230344



Basic Information


Item Value
gene id G230344
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 1062613 ~ 1062914 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU261392
TGTGTGTATGGGTTGCATCAAATACTCAGACAGTGCGACGGGGCTCTGAAGAAATGCAATTAGATCTGCCTACGTGACACAAAGGCATTCCTGTGATCTATATGCAGATTTCATGTAGGTGCACAGAAGTGATCTTTTCCCCCAAATGAGACATGACATTAACTTAGCACATATGTGTGGTCAAAGTGAGTTTGCATTATGCATACTGCTTTGAATGCTTAAAAGGATATAGTTCACCTAAAAATGAACATTCTGCCATAATTCATGACGTAGCAAAACCTGTATTGCTAAAAATGCTGGGT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU261392 True 302 lncRNA 0.40 1 1062613 1062914

Neighbor


gene id symbol gene type direction distance location
CI01000054_00979998_00989171 TCEB3 coding downstream 73442 979998 ~ 989171 (-)
CI01000054_00974025_00979306 PITHD1 coding downstream 83307 973900 ~ 979306 (-)
CI01000054_00965111_00970121 LYPLA2, LYPA2 coding downstream 92492 964642 ~ 970121 (-)
CI01000054_00929337_00955240 ANKIB1A coding downstream 106939 929132 ~ 955674 (-)
CI01000054_00924015_00926256 GATAD1 coding downstream 136357 923734 ~ 926256 (-)
CI01000054_01115294_01116274 GPR3, GPR6, GPR186 coding upstream 51779 1114693 ~ 1116822 (-)
CI01000054_01151083_01156699 FAM83HB coding upstream 87810 1150724 ~ 1158172 (-)
CI01000054_01203148_01209012 PPT1 coding upstream 139991 1202905 ~ 1209135 (-)
CI01000054_01246516_01250511 KLHL43 coding upstream 181967 1244881 ~ 1251249 (-)
CI01000054_01257527_01259314 NA coding upstream 194613 1257527 ~ 1259314 (-)
G230343 NA non-coding downstream 721 1061572 ~ 1061892 (-)
G230189 NA non-coding downstream 5171 1055550 ~ 1057442 (-)
G230342 NA non-coding downstream 32784 1029621 ~ 1029829 (-)
G230341 NA non-coding downstream 41733 1020674 ~ 1020880 (-)
G230336 NA non-coding downstream 43472 1015723 ~ 1019141 (-)
G230346 NA non-coding upstream 847 1063761 ~ 1063961 (-)
G230356 NA non-coding upstream 48352 1111266 ~ 1111518 (-)
G230251 NA non-coding upstream 81260 1144174 ~ 1144586 (-)
G230380 NA non-coding upstream 105576 1168490 ~ 1168820 (-)
G230178 NA non-coding upstream 163509 1185533 ~ 1230135 (-)
G230923 NA other upstream 1774323 2837237 ~ 2837682 (-)
CI01000054_02857402_02860451 NA other upstream 1791227 2857402 ~ 2860573 (-)
G230908 NA other upstream 1994734 3057648 ~ 3063343 (-)
G231645 NA other upstream 2918933 3981847 ~ 3982823 (-)

Expression



Co-expression Network