G229831



Basic Information


Item Value
gene id G229831
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 1161202 ~ 1161520 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU260809
AGGCGCACCCAGGTCATGATCACACTGTTGAGTGTTGTCTGTATGTCTGCTACAGATGGTATAAAAGATGAATTATTCATTCATAACGAAGGTTTTAAAGCTCCCTATTTCTATCTGAGTTCACATCAAAACAAGTTTATGTGCACGTGTAAACAATGACTTCAACCAAAACAATAGGCCTATTTCAAGCTTATTAAAAGTGAGTTATTTTTATTACAGGTATTTTTCCTAACAACAAACATCCATTCATTTCCTGTGGATGATCTTTTTCAATAAATATAACATTATATCGAATTTGATTATAAATATCATTCTCTCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU260809 True 319 lncRNA 0.32 1 1161202 1161520

Neighbor


gene id symbol gene type direction distance location
CI01000054_01133011_01143370 NA coding upstream 17590 1133011 ~ 1143612 (+)
CI01000054_01122882_01126143 NA coding upstream 34418 1122882 ~ 1126784 (+)
CI01000054_01103702_01106852 NA coding upstream 54350 1103441 ~ 1106852 (+)
CI01000054_01087465_01101501 AHDC1, METTL24 coding upstream 59428 1086932 ~ 1101774 (+)
CI01000054_01042925_01056338 NA coding upstream 104641 1042891 ~ 1056561 (+)
CI01000054_01173734_01187846 KIAA0319L coding downstream 12214 1173734 ~ 1188947 (+)
CI01000054_01190021_01201007 CAP1 coding downstream 28501 1190021 ~ 1201723 (+)
CI01000054_01212755_01219670 NA coding downstream 51026 1212546 ~ 1220783 (+)
CI01000054_01227110_01229796 EEF1A1L1 coding downstream 64859 1226335 ~ 1230329 (+)
CI01000054_01231236_01238870 NA coding downstream 69269 1230789 ~ 1239069 (+)
G229770 NA non-coding upstream 10056 1146290 ~ 1151146 (+)
G229806 NA non-coding upstream 16645 1144133 ~ 1144557 (+)
G229883 NA non-coding upstream 38851 1122092 ~ 1122351 (+)
G229872 NA non-coding upstream 102051 1058008 ~ 1059151 (+)
G229865 NA non-coding upstream 147801 1013175 ~ 1013401 (+)
G229891 NA non-coding downstream 7091 1168611 ~ 1168843 (+)
G229779 NA non-coding downstream 82254 1243774 ~ 1244341 (+)
G229919 NA non-coding downstream 143357 1304877 ~ 1305133 (+)
G229745 NA non-coding downstream 144850 1306370 ~ 1311971 (+)
G229746 NA non-coding downstream 153112 1314632 ~ 1331530 (+)
G229760 NA other downstream 104830 1266350 ~ 1273750 (+)
G229936 NA other downstream 235560 1397080 ~ 1407130 (+)
CI01000054_01578022_01579167 NA other downstream 416915 1578022 ~ 1579356 (+)
CI01000054_01650242_01665628 PLEKHO1A other downstream 489440 1650242 ~ 1666115 (+)

Expression



Co-expression Network