G229933



Basic Information


Item Value
gene id G229933
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 1390767 ~ 1391918 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU260929
CTAATAATAGAATTTGGCATAACGACATTATATAAAAGTTCACAGTGCATTAATAACTAATGTTATAGGTACAACTTTTGATCCTAAAAATGTATTAGTAAATGTAAACGAGAATAATATTAACTAAGATTAATAAATGCTGTAGAAGTATTTTTCATTGTTAGTTCATGTTAACTAATGGCCGATATTGTTTTTGCACCTGGTTTGCAGAGTTTCGAGCTGCTGTCTGAACGAGTGTGTGCAGATTTAGAGGTCCATGTTGGGCTGTCCGAATCTGTGCTGCTCCAAGGCCGAGGGTCATTCCAATGAGAGTCCAGCTCAAAGCTGCTCTGCCTGCTGCCGGACAGCCGACCCGAACCATCCCTGTTACCCTAAAGAGCTGGCGTCTTC

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU260929 True 390 lncRNA 0.41 2 1390767 1391918
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000054_01378423_01387679 CYHR1, CYHR1.L, CYHR1.S coding upstream 2504 1378293 ~ 1388263 (+)
CI01000054_01368287_01374709 DCLK3 coding upstream 15741 1368287 ~ 1375026 (+)
CI01000054_01353780_01357766 ZCCHC17 coding upstream 32908 1353568 ~ 1357859 (+)
CI01000054_01231236_01238870 NA coding upstream 151698 1230789 ~ 1239069 (+)
CI01000054_01227110_01229796 EEF1A1L1 coding upstream 160709 1226335 ~ 1230329 (+)
CI01000054_01535826_01544666 NA coding downstream 143908 1535826 ~ 1545550 (+)
CI01000054_01556797_01565522 FKBP9 coding downstream 164879 1556797 ~ 1565787 (+)
CI01000054_01568746_01575755 SYTL1 coding downstream 176828 1568746 ~ 1575755 (+)
CI01000054_01578022_01579167 NA coding downstream 186104 1578022 ~ 1579356 (+)
CI01000054_01589927_01595736 NA coding downstream 197050 1588883 ~ 1595857 (+)
G229746 NA non-coding upstream 59237 1314632 ~ 1331530 (+)
G229745 NA non-coding upstream 78796 1306370 ~ 1311971 (+)
G229919 NA non-coding upstream 85634 1304877 ~ 1305133 (+)
G229779 NA non-coding upstream 146426 1243774 ~ 1244341 (+)
G229891 NA non-coding upstream 221924 1168611 ~ 1168843 (+)
G229936 NA non-coding downstream 11256 1397080 ~ 1407130 (+)
G229822 NA non-coding downstream 21647 1413565 ~ 1413922 (+)
G229762 NA non-coding downstream 65876 1457794 ~ 1459261 (+)
G229792 NA non-coding downstream 76361 1468279 ~ 1472052 (+)
G229763 NA non-coding downstream 80273 1472191 ~ 1474920 (+)
G229760 NA other upstream 117017 1266350 ~ 1273750 (+)
CI01000054_01650242_01665628 PLEKHO1A other downstream 259042 1650242 ~ 1666115 (+)
CI01000054_01725792_01726688 NA other downstream 333751 1725627 ~ 1726793 (+)
CI01000054_02289802_02330591 SLC25A13 other downstream 897913 2289802 ~ 2330981 (+)

Expression


G229933 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 2.
End of interactive chart.

G229933 Expression in each Bioproject

Bar chart with 15 bars.
G229933 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 25.
End of interactive chart.

Co-expression Network