G229955


Basic Information

Item Value
gene id G229955
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 1504324 ~ 1504723 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU260953
AGCAGACAGTCTACTAATACTCTAATAAGAGTTAGTTGACATGTAGTTGCAAAGTTACTAATAGTAGAATGTCTAAAGTGGACTATCAAAATAAAGTGTAAACATGAATGCAAGGGAAATCACTTTCATTCCAATATATTTCAAATCTGGTAAAATACACATATATTAATAGGCTATACTCTACATGCACATGCTATATAGAGCCATATTTAATTGGTCATACCTGAAAAGGCTGGTATTCAAAAAGAGCCACAAATGAGTCGCAAAATGCTCCTTTAAATACGGGTGTGTCCAACCGGTGTGCATGTGCTACTATTTGTACAATTCTTCATCATAAATCACCCACAATACGCCCACAAACAATCTGCTAGATTGAAGTCATTAAAACTGACTCATATCA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU260953 True 400 lncRNA 0.35 1 1504324 1504723

Neighbor

gene id symbol gene type direction distance location
CI01000054_01378423_01387679 CYHR1, CYHR1.L, CYHR1.S coding upstream 116061 1378293 ~ 1388263 (+)
CI01000054_01368287_01374709 DCLK3 coding upstream 129298 1368287 ~ 1375026 (+)
CI01000054_01353780_01357766 ZCCHC17 coding upstream 146465 1353568 ~ 1357859 (+)
CI01000054_01231236_01238870 NA coding upstream 265255 1230789 ~ 1239069 (+)
CI01000054_01227110_01229796 EEF1A1L1 coding upstream 274266 1226335 ~ 1230329 (+)
CI01000054_01535826_01544666 NA coding downstream 31103 1535826 ~ 1545550 (+)
CI01000054_01556797_01565522 FKBP9 coding downstream 52074 1556797 ~ 1565787 (+)
CI01000054_01568746_01575755 SYTL1 coding downstream 64023 1568746 ~ 1575755 (+)
CI01000054_01578022_01579167 NA coding downstream 73299 1578022 ~ 1579356 (+)
CI01000054_01589927_01595736 NA coding downstream 84245 1588883 ~ 1595857 (+)
G229954 NA non-coding upstream 672 1503444 ~ 1503652 (+)
G229953 NA non-coding upstream 2428 1501315 ~ 1501896 (+)
G229763 NA non-coding upstream 29404 1472191 ~ 1474920 (+)
G229792 NA non-coding upstream 32272 1468279 ~ 1472052 (+)
G229762 NA non-coding upstream 45063 1457794 ~ 1459261 (+)
G229811 NA non-coding downstream 3310 1508033 ~ 1508480 (+)
G229956 NA non-coding downstream 3847 1508570 ~ 1509799 (+)
G229764 NA non-coding downstream 8421 1513144 ~ 1514004 (+)
G229958 NA non-coding downstream 11612 1516335 ~ 1518558 (+)
G229815 NA non-coding downstream 80614 1585337 ~ 1586014 (+)
G229936 NA other upstream 97194 1397080 ~ 1407130 (+)
G229760 NA other upstream 230574 1266350 ~ 1273750 (+)
CI01000054_01650242_01665628 PLEKHO1A other downstream 146237 1650242 ~ 1666115 (+)
CI01000054_01725792_01726688 NA other downstream 220946 1725627 ~ 1726793 (+)
CI01000054_02289802_02330591 SLC25A13 other downstream 785108 2289802 ~ 2330981 (+)
G230689 NA other downstream 1573779 3078502 ~ 3087392 (+)

Expression


Co-expression Network