G230622



Basic Information


Item Value
gene id G230622
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 2122321 ~ 2122664 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU261756
CAAAGCTGGAGAATCTCACACAGCCAAAATGAGGATTGTCAGTAACGGTGTTCAGCCTTACATTGTTCAAACCGGAGTCGGACACTGATGGAGAGACTCAGGAAGAAGTTACAACTTTTACAATGAAACTGGACATTTCTGAATGGTTAGTGGATAAATTTATGTAGTTGCTGTGGAGTTGATTCAACTCATCGACTAGCATGTGCCGTCATGTTAATCTTTTGTGCAAATCCAGCGTTGAATTGAGCCTCGTTTGTGAAGCAGTCCGGAGTAAAATGACGGCATGGTAACAACACACTACTACAACAACTCTTCCTCTTCTCTAAAGCAGCCCAACATGGCCT

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU261756 True 344 lncRNA 0.43 1 2122321 2122664
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000054_02096054_02105211 GNRHR1, GNRH-R coding upstream 17056 2096054 ~ 2105265 (+)
CI01000054_02024879_02026284 NA coding upstream 94742 2024879 ~ 2027615 (+)
CI01000054_01879983_01965668 TRIO, TRIOA coding upstream 156162 1879983 ~ 1966159 (+)
CI01000054_01871659_01875753 NA coding upstream 246111 1871548 ~ 1876210 (+)
CI01000054_01725792_01726688 NA coding upstream 395581 1725627 ~ 1726793 (+)
CI01000054_02195667_02196307 CHRAC1 coding downstream 73003 2195667 ~ 2196853 (+)
CI01000054_02225261_02226820 DLX5, DLX5A coding downstream 101863 2224527 ~ 2227071 (+)
CI01000054_02239241_02261796 NA coding downstream 115660 2238324 ~ 2261858 (+)
CI01000054_02272856_02274337 SHFM1, SHFM1.S, DSS1 coding downstream 148525 2271189 ~ 2274545 (+)
CI01000054_02289802_02330591 SLC25A13 coding downstream 167138 2289802 ~ 2330981 (+)
G230617 NA non-coding upstream 6504 2115436 ~ 2115817 (+)
G230606 NA non-coding upstream 13646 2105720 ~ 2108675 (+)
G230475 NA non-coding upstream 39862 2082025 ~ 2082459 (+)
G230500 NA non-coding upstream 103953 2016274 ~ 2018368 (+)
G230624 NA non-coding downstream 1703 2124367 ~ 2124737 (+)
G230632 NA non-coding downstream 9033 2131697 ~ 2132037 (+)
G230634 NA non-coding downstream 10580 2133244 ~ 2133556 (+)
G230659 NA non-coding downstream 56177 2178841 ~ 2179094 (+)
CI01000054_01650242_01665628 PLEKHO1A other upstream 460756 1650242 ~ 1666115 (+)
CI01000054_01578022_01579167 NA other upstream 540252 1578022 ~ 1579356 (+)
G229936 NA other upstream 715191 1397080 ~ 1407130 (+)
G229760 NA other upstream 848571 1266350 ~ 1273750 (+)
G230689 NA other downstream 955838 3078502 ~ 3087392 (+)
CI01000054_03848427_03914231 NA other downstream 1785787 3848427 ~ 3914231 (+)
G231863 NA other downstream 2284488 4407152 ~ 4450730 (+)
CI01000054_05608892_05634793 RNF19B other downstream 3500351 5608457 ~ 5634804 (+)

Expression


G230622 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 10.
End of interactive chart.

G230622 Expression in each Bioproject

Bar chart with 38 bars.
G230622 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 600.
End of interactive chart.

Co-expression Network