G230782


Basic Information

Item Value
gene id G230782
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 2492563 ~ 2492815 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU261933
ATTCAATTTTAATTCCCATGTAAATGCATTTATGCTGCCTCTGTGCAGCAATAAATAGTCTGTGTAAATGCACTTTTTTGTGTTAGCTATATGCCACTTCAGATGCAGCGTCTGTGCCGCCTTTGCAGCATACACGTGGCATAAAGCCATTAATAAGTGTTTTGAGGACGAAATATGAATTATAAACGTTAAAAAAACTTAATTATTCAAAGAGTGCGAAACACAGGATATTTATTCTTCTAGCTATAGAGGC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU261933 True 253 lncRNA 0.36 1 2492563 2492815

Neighbor

gene id symbol gene type direction distance location
CI01000054_02417068_02430580 PDK4 coding upstream 61247 2417068 ~ 2431316 (+)
CI01000054_02289802_02330591 SLC25A13 coding upstream 161582 2289802 ~ 2330981 (+)
CI01000054_02272856_02274337 SHFM1, SHFM1.S, DSS1 coding upstream 218038 2271189 ~ 2274545 (+)
CI01000054_02239241_02261796 NA coding upstream 230705 2238324 ~ 2261858 (+)
CI01000054_02225261_02226820 DLX5, DLX5A coding upstream 265492 2224527 ~ 2227071 (+)
CI01000054_02500503_02511195 SGCE coding downstream 7688 2500503 ~ 2511195 (+)
CI01000054_02564258_02570248 NA coding downstream 70877 2563692 ~ 2570405 (+)
CI01000054_02589793_02592201 BET1 coding downstream 96978 2589793 ~ 2592926 (+)
CI01000054_02613166_02614884 TFPI2 coding downstream 120243 2613058 ~ 2615458 (+)
CI01000054_02652696_02685815 CALCR coding downstream 159881 2652696 ~ 2685833 (+)
G230781 NA non-coding upstream 5307 2487023 ~ 2487256 (+)
G230780 NA non-coding upstream 5866 2486432 ~ 2486697 (+)
G230779 NA non-coding upstream 10195 2482131 ~ 2482368 (+)
G230778 NA non-coding upstream 12830 2479398 ~ 2479733 (+)
G230777 NA non-coding upstream 14719 2477632 ~ 2477844 (+)
G230783 NA non-coding downstream 81 2492896 ~ 2493128 (+)
G230711 NA non-coding downstream 52819 2545634 ~ 2546398 (+)
G230798 NA non-coding downstream 88481 2581296 ~ 2581522 (+)
G230710 NA non-coding downstream 89596 2582411 ~ 2583773 (+)
G230802 NA non-coding downstream 94100 2586915 ~ 2587138 (+)
CI01000054_01725792_01726688 NA other upstream 765770 1725627 ~ 1726793 (+)
CI01000054_01650242_01665628 PLEKHO1A other upstream 830998 1650242 ~ 1666115 (+)
CI01000054_01578022_01579167 NA other upstream 910494 1578022 ~ 1579356 (+)
G229936 NA other upstream 1085433 1397080 ~ 1407130 (+)
G230689 NA other downstream 585687 3078502 ~ 3087392 (+)
CI01000054_03848427_03914231 NA other downstream 1415636 3848427 ~ 3914231 (+)
G231863 NA other downstream 1914337 4407152 ~ 4450730 (+)
CI01000054_05608892_05634793 RNF19B other downstream 3130200 5608457 ~ 5634804 (+)
G232558 NA other downstream 3500845 5993660 ~ 6041863 (+)

Expression


Co-expression Network