G230798


Basic Information

Item Value
gene id G230798
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 2581296 ~ 2581522 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU261949
ATTTAACCAATATTAATTAAAAGAGTTTTCTTTTAAATCTCTGCCCGGTGCTTTTTGTGAGGACTTAAGAAGGTCTCAATGACTTACATTTACATTTGAAAACACGTTCAGCAAAGATAATTGCTGTTATTCTGTATAGGGAAAAGGCTGCATATAGAAGCATGAAGTGAATGTTGTTTTGTTGAGTTTGTAGTTTTCTAGAAATACATCTGGAGGTGGGCGATATG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU261949 True 227 lncRNA 0.34 1 2581296 2581522

Neighbor

gene id symbol gene type direction distance location
CI01000054_02564258_02570248 NA coding upstream 10891 2563692 ~ 2570405 (+)
CI01000054_02500503_02511195 SGCE coding upstream 70101 2500503 ~ 2511195 (+)
CI01000054_02417068_02430580 PDK4 coding upstream 149980 2417068 ~ 2431316 (+)
CI01000054_02289802_02330591 SLC25A13 coding upstream 250315 2289802 ~ 2330981 (+)
CI01000054_02272856_02274337 SHFM1, SHFM1.S, DSS1 coding upstream 306771 2271189 ~ 2274545 (+)
CI01000054_02589793_02592201 BET1 coding downstream 8271 2589793 ~ 2592926 (+)
CI01000054_02613166_02614884 TFPI2 coding downstream 31536 2613058 ~ 2615458 (+)
CI01000054_02652696_02685815 CALCR coding downstream 71174 2652696 ~ 2685833 (+)
CI01000054_02824071_02824355 NA coding downstream 242503 2824025 ~ 2824642 (+)
CI01000054_02951289_02967370 NA coding downstream 369393 2950915 ~ 2967660 (+)
G230711 NA non-coding upstream 34898 2545634 ~ 2546398 (+)
G230783 NA non-coding upstream 88168 2492896 ~ 2493128 (+)
G230782 NA non-coding upstream 88481 2492563 ~ 2492815 (+)
G230781 NA non-coding upstream 94040 2487023 ~ 2487256 (+)
G230780 NA non-coding upstream 94599 2486432 ~ 2486697 (+)
G230710 NA non-coding downstream 889 2582411 ~ 2583773 (+)
G230802 NA non-coding downstream 5393 2586915 ~ 2587138 (+)
G230812 NA non-coding downstream 29874 2611396 ~ 2612378 (+)
G230707 NA non-coding downstream 51769 2633291 ~ 2689215 (+)
G230816 NA non-coding downstream 114991 2696513 ~ 2697025 (+)
CI01000054_01725792_01726688 NA other upstream 854503 1725627 ~ 1726793 (+)
CI01000054_01650242_01665628 PLEKHO1A other upstream 919731 1650242 ~ 1666115 (+)
CI01000054_01578022_01579167 NA other upstream 999227 1578022 ~ 1579356 (+)
G229936 NA other upstream 1174166 1397080 ~ 1407130 (+)
G230689 NA other downstream 496980 3078502 ~ 3087392 (+)
CI01000054_03848427_03914231 NA other downstream 1326929 3848427 ~ 3914231 (+)
G231863 NA other downstream 1825630 4407152 ~ 4450730 (+)
CI01000054_05608892_05634793 RNF19B other downstream 3041493 5608457 ~ 5634804 (+)
G232558 NA other downstream 3412138 5993660 ~ 6041863 (+)

Expression


Co-expression Network