G231273


Basic Information

Item Value
gene id G231273
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 3410599 ~ 3410925 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU262458
CTAGAGACTGCGATTGTTAGCTTCCTTGTTAGAGTACCCGACTCCCATGCCAGCGGACCCAGGTTCGAGTCCCGCTTAGAGCGGATGGTTTGAACAGGAGGGGTTACATTGGTGCCGTGACCCGGATGGGAGTGAGGTTTAGGGGGGGTGAGTGTAACAGACGTAGGCTAGTAAGAGCTGTGCATGTAAATCTCACTCCCCTGATCTCAAGAGGTGCTAGACTGACACTAGAGACTGCTATCTTTAGCCTCCTTGTTAGAGCGCCTGACTCCCATGCCAACGGACCAGGGTTCGAGTCCCGCTTAGAGCGGGCGGTTCAAACAGGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU262458 True 327 lncRNA 0.55 1 3410599 3410925

Neighbor

gene id symbol gene type direction distance location
CI01000054_03016199_03016501 NA coding upstream 393906 3015959 ~ 3016693 (+)
CI01000054_02975008_02985278 EFCAB1 coding upstream 425264 2974588 ~ 2985335 (+)
CI01000054_02951289_02967370 NA coding upstream 442939 2950915 ~ 2967660 (+)
CI01000054_02824071_02824355 NA coding upstream 585957 2824025 ~ 2824642 (+)
CI01000054_02652696_02685815 CALCR coding upstream 724766 2652696 ~ 2685833 (+)
CI01000054_03424472_03425704 NA coding downstream 12129 3423054 ~ 3426433 (+)
CI01000054_03558982_03663042 ADGRB2 coding downstream 148057 3558982 ~ 3663042 (+)
CI01000054_03670684_03671857 NA coding downstream 259759 3670684 ~ 3672003 (+)
CI01000054_03707961_03761024 ADGRB2 coding downstream 296910 3707835 ~ 3761112 (+)
CI01000054_03848427_03914231 NA coding downstream 437502 3848427 ~ 3914231 (+)
G231270 NA non-coding upstream 5080 3405217 ~ 3405519 (+)
G231209 NA non-coding upstream 51066 3359271 ~ 3359533 (+)
G231015 NA non-coding upstream 270936 3139393 ~ 3139663 (+)
G230856 NA non-coding upstream 353380 3056864 ~ 3057219 (+)
G230700 NA non-coding upstream 407482 3001195 ~ 3003117 (+)
G231286 NA non-coding downstream 22383 3433308 ~ 3433582 (+)
G231293 NA non-coding downstream 38855 3449780 ~ 3450241 (+)
G231294 NA non-coding downstream 40466 3451391 ~ 3451658 (+)
G231295 NA non-coding downstream 41406 3452331 ~ 3452550 (+)
G231350 NA non-coding downstream 421377 3832302 ~ 3832605 (+)
G230689 NA other upstream 323207 3078502 ~ 3087392 (+)
CI01000054_02289802_02330591 SLC25A13 other upstream 1106217 2289802 ~ 2330981 (+)
CI01000054_01725792_01726688 NA other upstream 1683806 1725627 ~ 1726793 (+)
CI01000054_01650242_01665628 PLEKHO1A other upstream 1749034 1650242 ~ 1666115 (+)
CI01000054_01578022_01579167 NA other upstream 1828530 1578022 ~ 1579356 (+)
G231863 NA other downstream 996227 4407152 ~ 4450730 (+)
CI01000054_05608892_05634793 RNF19B other downstream 2212090 5608457 ~ 5634804 (+)
G232558 NA other downstream 2582735 5993660 ~ 6041863 (+)
CI01000054_06305908_06312122 NA other downstream 2893382 6305908 ~ 6312163 (+)

Expression


Co-expression Network