G232379


Basic Information

Item Value
gene id G232379
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 5400368 ~ 5401112 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU263682
CTCGAACAAGCTTATAGACAATCAGCAAAAGTGTGCATCAGTGTGCAACAACAAGGACTCTGGGAGTGACACTAAGGATGATGGGAATGACTCTTAATCATTTGACCACTGATCCAAAGATCAGAAAGCTGTGGGGAAAAAATAGCAACATCCTGACAGAGAGAGCATTACTTGCTTCTATATTGGAGGTTGAGATAATGGACTTTGGCTGCACTAACCATTTCATGAAATCTCACTATAAGACATTCATAGAAAAACCTGCGGAGATCTAAACTCCCACATCGGACAAAACATTTCCATAGCCACTGATCCACACTGATTATAAAGGTAAGTAAGTATCATGATATACTGTAAAGAGCAAACAGTAGAAAACACATCATGGTCATGGTCATCTCAAATGGTTCTCTTGTCCACCTGAAATGCAATCAAGATGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU263682 True 435 lncRNA 0.40 4 5400368 5401112

Neighbor

gene id symbol gene type direction distance location
CI01000054_05145255_05217807 CSMD2 coding upstream 182557 5145111 ~ 5217811 (+)
CI01000054_04962081_04977729 NA coding upstream 422431 4961930 ~ 4977937 (+)
CI01000054_04924205_04945546 NA coding upstream 454527 4924159 ~ 4945841 (+)
CI01000054_04658039_04659082 NA coding upstream 740667 4657991 ~ 4659701 (+)
CI01000054_04453321_04456780 ILF2, ILF2.L coding upstream 943260 4453321 ~ 4457108 (+)
CI01000054_05402279_05408977 TRAPPC3.S, TRAPPC3, TPPC3 coding downstream 335 5401447 ~ 5409085 (+)
CI01000054_05409518_05413525 NA coding downstream 8190 5409302 ~ 5413987 (+)
CI01000054_05538535_05543989 COL8A2 coding downstream 136296 5537408 ~ 5545034 (+)
CI01000054_05567094_05576916 PTP4A1, PTP4A2.L, TP4A2, PTP4A2B, PTP4A2 coding downstream 165982 5567094 ~ 5577023 (+)
CI01000054_05579068_05592326 ANLN coding downstream 177956 5579068 ~ 5592503 (+)
G232368 NA non-coding upstream 42696 5357241 ~ 5357672 (+)
G232293 NA non-coding upstream 139606 5259996 ~ 5260762 (+)
G232116 NA non-coding upstream 218909 5102226 ~ 5181459 (+)
G232094 NA non-coding upstream 507326 4892757 ~ 4893042 (+)
G232077 NA non-coding upstream 563850 4836279 ~ 4836518 (+)
G232443 NA non-coding downstream 17520 5418632 ~ 5418869 (+)
G232467 NA non-coding downstream 72933 5474045 ~ 5474333 (+)
G232499 NA non-coding downstream 226460 5627572 ~ 5627795 (+)
CI01000054_05696772_05708538 NA non-coding downstream 293225 5696093 ~ 5708637 (+)
G232519 NA non-coding downstream 437171 5838283 ~ 5838874 (+)
G231863 NA other upstream 949638 4407152 ~ 4450730 (+)
CI01000054_03848427_03914231 NA other upstream 1486822 3848427 ~ 3914231 (+)
G230689 NA other upstream 2312976 3078502 ~ 3087392 (+)
CI01000054_02289802_02330591 SLC25A13 other upstream 3095986 2289802 ~ 2330981 (+)
CI01000054_01725792_01726688 NA other upstream 3673575 1725627 ~ 1726793 (+)
CI01000054_05608892_05634793 RNF19B other downstream 221903 5608457 ~ 5634804 (+)
G232558 NA other downstream 592548 5993660 ~ 6041863 (+)
CI01000054_06305908_06312122 NA other downstream 903195 6305908 ~ 6312163 (+)
G232659 NA other downstream 973738 6374850 ~ 6375894 (+)
G232870 NA other downstream 1486800 6887912 ~ 6888503 (+)

Expression


Co-expression Network