G232532



Basic Information


Item Value
gene id G232532
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 5872373 ~ 5872855 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU263852
TGTCCGTACTGCATACCCTCAGATGAAATCCTGCAGGTTCCACTGCACTGCTTTGTAAACAGCTGAACCACTGACCTGACTGTTTTATTTAGGTACTCACACTGCATTGAAAGTATGAGTGAAGACTGTTTGAATCGCATACAGGAGTATATGTATTGTTTTAAAACAATAGAAGGTGCTGTCATAGAGCTGCAGGTTTATTTGGCAAGTCTGAGGTGTGTGAATTCCATGTGCTTGTGCTGTTTAAAAGTAAAAATTCAGTCATTTATATTTAAATGAAAATGATTGTGATCTCAAAAAAAGTGTCATTGATGTGATTAAAGAGAGCCGTATTTGTGGTATTGGCATGAGCTGGTCTGTATGGCAATAAATCAAGTTGAGAAGGGGTGAGAAGCAAGCGGATGATATGCAGTTGATCAGAAGAACAGTGCTGATGGCTTTCCCAGACTGTGAAGATCACTCAGGAAATTTTTGACTCCAATT

Function


GO: NA

KEGG: NA

RNA


RNA id representative length rna type GC content exon number start site end site
TU263852 True 483 lncRNA 0.39 1 5872373 5872855
Loading

Neighbor


gene id symbol gene type direction distance location
CI01000054_05841632_05851621 NDRG1A coding upstream 19846 5841496 ~ 5852527 (+)
CI01000054_05830867_05831873 NA coding upstream 40420 5830809 ~ 5831953 (+)
CI01000054_05825039_05827325 PSMA2, PSA2 coding upstream 44995 5823806 ~ 5827378 (+)
CI01000054_05813838_05819498 BMP8A coding upstream 52633 5812764 ~ 5819740 (+)
CI01000054_05772612_05808901 MACF1, MACF1A coding upstream 63007 5772452 ~ 5809366 (+)
CI01000054_05875546_05877938 SLA1 coding downstream 2624 5875479 ~ 5878322 (+)
CI01000054_05926683_05953807 CTNNAL1 coding downstream 53828 5926683 ~ 5953955 (+)
CI01000054_05957906_05981499 ELP2 coding downstream 84544 5957399 ~ 5982222 (+)
CI01000054_05989042_05989389 NA coding downstream 116187 5989042 ~ 5989795 (+)
CI01000054_06292147_06297237 NA coding downstream 419121 6291976 ~ 6297560 (+)
G232530 NA non-coding upstream 1950 5870198 ~ 5870423 (+)
G232526 NA non-coding upstream 5284 5866867 ~ 5867089 (+)
G232521 NA non-coding upstream 12496 5859620 ~ 5859877 (+)
G232519 NA non-coding upstream 33499 5838283 ~ 5838874 (+)
CI01000054_05696772_05708538 NA non-coding upstream 171122 5696093 ~ 5708637 (+)
G232539 NA non-coding downstream 16939 5889794 ~ 5890005 (+)
G232545 NA non-coding downstream 21893 5894748 ~ 5894967 (+)
G232501 NA non-coding downstream 45204 5918059 ~ 6346633 (+)
G232606 NA non-coding downstream 261662 6134517 ~ 6136029 (+)
G232648 NA non-coding downstream 413410 6286265 ~ 6287079 (+)
CI01000054_05608892_05634793 RNF19B other upstream 247698 5608457 ~ 5634804 (+)
G231863 NA other upstream 1421643 4407152 ~ 4450730 (+)
CI01000054_03848427_03914231 NA other upstream 1958827 3848427 ~ 3914231 (+)
G230689 NA other upstream 2784981 3078502 ~ 3087392 (+)
CI01000054_02289802_02330591 SLC25A13 other upstream 3567991 2289802 ~ 2330981 (+)
G232558 NA other downstream 120805 5993660 ~ 6041863 (+)
CI01000054_06305908_06312122 NA other downstream 431452 6305908 ~ 6312163 (+)
G232659 NA other downstream 501995 6374850 ~ 6375894 (+)
G232870 NA other downstream 1015057 6887912 ~ 6888503 (+)
G233024 NA other downstream 1694668 7567523 ~ 7609893 (+)

Expression


G232532 Expression in PRJCA010000

Bar chart with 27 bars.
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying values. Range: 0 to 0.03.
End of interactive chart.

G232532 Expression in each Bioproject

Bar chart with 24 bars.
G232532 Expression in each Sample
The chart has 1 X axis displaying categories.
The chart has 1 Y axis displaying Expression. Range: 0 to 30.
End of interactive chart.

Co-expression Network