G233539


Basic Information

Item Value
gene id G233539
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 6317321 ~ 6325541 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU264992
AAAGAAATTAAGGTTTTTGAGGAAAACATTCCAGGATTTTTCTCCATATATTACTGACTTCATTGGGGTACAACGGGTTGAAGGTCCAAATTGCAGTTTCAATGCAGCTTCAAAGGGCCCCATGTCATCCAAGATGTTTATGTCTTTCTTTCTTCAGTCGAAAAGAAATTAAGGTTTTTGATGAAAACATTCCAGGATTATTCTCCTTATAGTGGACTTCAATTGGCCCCAAACGGCTGAAGGTCAAAATTTCAGTTTCAGTGCAGCTTCAAAGGGCTTTAAACGATACCAGACGAGGAATAAGGGTCTTATCTAGTAAAAAGATCGGTCATTTTCTAAAAAAAATAAAAAATTATATACGTTTTAACCATAGACGCTCGTCTTGAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU264992 True 388 lncRNA 0.36 2 6317321 6325541

Neighbor

gene id symbol gene type direction distance location
CI01000054_06283619_06286512 NA coding downstream 30645 6280544 ~ 6286767 (-)
CI01000054_06242813_06258348 POC1BL coding downstream 58973 6242741 ~ 6258348 (-)
CI01000054_06222549_06234979 GALNT12 coding downstream 82249 6222467 ~ 6235072 (-)
CI01000054_06210877_06211356 NA coding downstream 105846 6210807 ~ 6211475 (-)
CI01000054_05990266_06191955 GABBR2 coding downstream 125366 5990266 ~ 6191955 (-)
CI01000054_06422150_06433402 PEX1 coding upstream 96267 6421808 ~ 6433689 (-)
CI01000054_06469564_06492881 RUNX1T1 coding upstream 143311 6468852 ~ 6492881 (-)
CI01000054_06503408_06508723 NA coding upstream 177692 6503233 ~ 6510068 (-)
CI01000054_06629482_06641861 TRIQK coding upstream 303764 6628082 ~ 6642160 (-)
CI01000054_06830485_06831336 FAM84B coding upstream 503451 6828992 ~ 6831336 (-)
G233392 NA non-coding downstream 464614 5760299 ~ 5852707 (-)
CI01000054_05822181_05823458 ZN706, ZNF706, ZFP706 non-coding downstream 493195 5822146 ~ 5823684 (-)
G233420 NA non-coding downstream 566043 5750346 ~ 5751278 (-)
G233356 NA non-coding downstream 842929 5474145 ~ 5474392 (-)
G233581 NA non-coding upstream 87542 6413083 ~ 6413708 (-)
G233585 NA non-coding upstream 93064 6418605 ~ 6418858 (-)
G233590 NA non-coding upstream 97240 6422781 ~ 6423081 (-)
G233588 NA non-coding upstream 109207 6434748 ~ 6436431 (-)
G233592 NA non-coding upstream 112161 6437702 ~ 6437903 (-)
G232274 NA other downstream 1108081 5206199 ~ 5209240 (-)
CI01000054_04671351_04681181 PEF1 other downstream 1645088 4670151 ~ 4681361 (-)
G231645 NA other downstream 2334498 3981847 ~ 3982823 (-)
G230908 NA other downstream 3253978 3057648 ~ 3063343 (-)
CI01000054_02857402_02860451 NA other downstream 3456748 2857402 ~ 2860573 (-)
CI01000054_07165957_07169539 HEYL other upstream 839894 7165435 ~ 7169539 (-)
G235216 NA other upstream 2922498 9248039 ~ 9248538 (-)
CI01000054_09483912_09484282 MRPL36 other upstream 3157606 9483147 ~ 9484282 (-)
CI01000054_09864693_09866871 PPP1R11 other upstream 3537780 9863321 ~ 9867212 (-)

Expression


Co-expression Network