G233585


Basic Information

Item Value
gene id G233585
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 6418605 ~ 6418858 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU265049
CAATGCCACTTGGTTTTATTTCCTGACAAGATTTTAATGACAGCTTTGTTTCTTAACGAGATTTTAATGACAGTCAGCTTTGTTTCTTAACGAGATTTTAATGACAGTTGGTTTTGTTCAGTCAGAAGATTTCAATGATGGTCGGTTTTGTTTGGTTACGAGATCTCAATGGCAGTCGGTTTTCAGTGTCAGTCGCTTTTGTTCTTTTGCAAGATTTCAAAAACAGTTGATCTTGTTTCTTTACGAGATTTCAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU265049 True 254 lncRNA 0.35 1 6418605 6418858

Neighbor

gene id symbol gene type direction distance location
CI01000054_06321499_06337371 NA coding downstream 80838 6321269 ~ 6337767 (-)
CI01000054_06283619_06286512 NA coding downstream 131929 6280544 ~ 6286767 (-)
CI01000054_06242813_06258348 POC1BL coding downstream 160257 6242741 ~ 6258348 (-)
CI01000054_06222549_06234979 GALNT12 coding downstream 183533 6222467 ~ 6235072 (-)
CI01000054_06210877_06211356 NA coding downstream 207130 6210807 ~ 6211475 (-)
CI01000054_06422150_06433402 PEX1 coding upstream 2950 6421808 ~ 6433689 (-)
CI01000054_06469564_06492881 RUNX1T1 coding upstream 49994 6468852 ~ 6492881 (-)
CI01000054_06503408_06508723 NA coding upstream 84375 6503233 ~ 6510068 (-)
CI01000054_06629482_06641861 TRIQK coding upstream 210447 6628082 ~ 6642160 (-)
CI01000054_06830485_06831336 FAM84B coding upstream 410134 6828992 ~ 6831336 (-)
G233581 NA non-coding downstream 4897 6413083 ~ 6413708 (-)
G233539 NA non-coding downstream 93064 6317321 ~ 6325541 (-)
G233392 NA non-coding downstream 565898 5760299 ~ 5852707 (-)
CI01000054_05822181_05823458 ZN706, ZNF706, ZFP706 non-coding downstream 594479 5822146 ~ 5823684 (-)
G233590 NA non-coding upstream 3923 6422781 ~ 6423081 (-)
G233588 NA non-coding upstream 15890 6434748 ~ 6436431 (-)
G233592 NA non-coding upstream 18844 6437702 ~ 6437903 (-)
G233593 NA non-coding upstream 19736 6438594 ~ 6438880 (-)
G233594 NA non-coding upstream 22247 6441105 ~ 6441497 (-)
G232274 NA other downstream 1209365 5206199 ~ 5209240 (-)
CI01000054_04671351_04681181 PEF1 other downstream 1746372 4670151 ~ 4681361 (-)
G231645 NA other downstream 2435782 3981847 ~ 3982823 (-)
G230908 NA other downstream 3355262 3057648 ~ 3063343 (-)
CI01000054_02857402_02860451 NA other downstream 3558032 2857402 ~ 2860573 (-)
CI01000054_07165957_07169539 HEYL other upstream 746577 7165435 ~ 7169539 (-)
G235216 NA other upstream 2829181 9248039 ~ 9248538 (-)
CI01000054_09483912_09484282 MRPL36 other upstream 3064289 9483147 ~ 9484282 (-)
CI01000054_09864693_09866871 PPP1R11 other upstream 3444463 9863321 ~ 9867212 (-)

Expression


Co-expression Network