G232721


Basic Information

Item Value
gene id G232721
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 6537979 ~ 6538207 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU264084
GTCAAAAGTACCCACTTCGGTACCTAGTCTAGTTGATACTGAAGTTTTAAAAATTTGACACTTTGAGCACTGTTGAGCGGATTTGTAAACACCTCTGATTGGCCATTGTGTTCACGGCTCATCAGATATGTCTGTGATTGGCTACAATGATCAACGCTGTAAAAACGTTCAATGAAGCTCTTCACCAAGCGCTTACACAGATACACACAGAAGCGTTTGAAAGCAGGCG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU264084 True 229 lncRNA 0.42 1 6537979 6538207

Neighbor

gene id symbol gene type direction distance location
CI01000054_06437628_06441214 NA coding upstream 96498 6437628 ~ 6441481 (+)
CI01000054_06434217_06435680 OTUD6B coding upstream 102299 6433756 ~ 6435680 (+)
CI01000054_06411594_06411984 NA coding upstream 125458 6411594 ~ 6412521 (+)
CI01000054_06305908_06312122 NA coding upstream 225816 6305908 ~ 6312163 (+)
CI01000054_06292147_06297237 NA coding upstream 240419 6291976 ~ 6297560 (+)
CI01000054_06756071_06757443 NA coding downstream 217602 6755809 ~ 6757514 (+)
CI01000054_06759472_06761310 NA coding downstream 220604 6758811 ~ 6761310 (+)
CI01000054_06789505_06789810 NA coding downstream 250155 6788362 ~ 6789946 (+)
CI01000054_06795526_06796596 TRIB1 coding downstream 257319 6795526 ~ 6796644 (+)
CI01000054_06865381_06869404 KLHL38A, KLHL38 coding downstream 327174 6865381 ~ 6869942 (+)
G232719 NA non-coding upstream 4749 6533021 ~ 6533230 (+)
G232691 NA non-coding upstream 74723 6463027 ~ 6463256 (+)
G232689 NA non-coding upstream 77854 6459881 ~ 6460125 (+)
G232684 NA non-coding upstream 85911 6451858 ~ 6452068 (+)
G232674 NA non-coding upstream 108547 6429131 ~ 6429432 (+)
G232728 NA non-coding downstream 17201 6555408 ~ 6555639 (+)
G232735 NA non-coding downstream 45424 6583631 ~ 6583921 (+)
G232736 NA non-coding downstream 48078 6586285 ~ 6586712 (+)
G232739 NA non-coding downstream 54727 6592934 ~ 6593225 (+)
G232740 NA non-coding downstream 55076 6593283 ~ 6593490 (+)
G232659 NA other upstream 162085 6374850 ~ 6375894 (+)
G232558 NA other upstream 496116 5993660 ~ 6041863 (+)
CI01000054_05608892_05634793 RNF19B other upstream 913304 5608457 ~ 5634804 (+)
G231863 NA other upstream 2087249 4407152 ~ 4450730 (+)
G232870 NA other downstream 349705 6887912 ~ 6888503 (+)
G233024 NA other downstream 1029316 7567523 ~ 7609893 (+)
G233306 NA other downstream 1766392 8304599 ~ 8304949 (+)
CI01000054_08325126_08329621 HPCAL4, VSNL1, VSNL1.S other downstream 1767730 8325126 ~ 8329716 (+)
G235560 NA other downstream 3849929 10388136 ~ 10392378 (+)

Expression


Co-expression Network