G233685



Basic Information


Item Value
gene id G233685
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 6619674 ~ 6619899 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU265159
CAGACAACCCAGAAAAACGTGCATCACAAACGCTTCACATAAATGCATTTGCAACACTTTAAATGTCCAGTGAGTGGCGCTAAAAGCGTTTTTATCCTAAACAGATGATGAACGTGAATCTGGTAACGTTGGCTGTTGTTCGGGAATGAAATGTCCGGTGAGTGCAGCTAAAAGTTTAATGCTAATTTGAAAATAACTACCACCAACACTAAACACTATACCCTAA

Function


NR:

description
PREDICTED: NADH-ubiquinone oxidoreductase 75 kDa subunit, mitochondrial-like

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU265159 True 226 lncRNA 0.39 1 6619674 6619899

Neighbor


gene id symbol gene type direction distance location
CI01000054_06503408_06508723 NA coding downstream 109606 6503233 ~ 6510068 (-)
CI01000054_06469564_06492881 RUNX1T1 coding downstream 126793 6468852 ~ 6492881 (-)
CI01000054_06422150_06433402 PEX1 coding downstream 185985 6421808 ~ 6433689 (-)
CI01000054_06321499_06337371 NA coding downstream 281907 6321269 ~ 6337767 (-)
CI01000054_06283619_06286512 NA coding downstream 332998 6280544 ~ 6286767 (-)
CI01000054_06629482_06641861 TRIQK coding upstream 9406 6628082 ~ 6642160 (-)
CI01000054_06830485_06831336 FAM84B coding upstream 209093 6828992 ~ 6831336 (-)
CI01000054_06835747_06861855 FAM91A1 coding upstream 214521 6834420 ~ 6863079 (-)
CI01000054_06874039_06875193 NA coding upstream 253421 6873320 ~ 6875309 (-)
CI01000054_06895032_06942103 SPIRE1A coding upstream 274929 6894828 ~ 6942362 (-)
G233678 NA non-coding downstream 10810 6608508 ~ 6608864 (-)
G233677 NA non-coding downstream 11591 6607832 ~ 6608083 (-)
G233577 NA non-coding downstream 95694 6513490 ~ 6523980 (-)
G233608 NA non-coding downstream 161278 6458178 ~ 6458396 (-)
G233601 NA non-coding downstream 168774 6450682 ~ 6450900 (-)
G233689 NA non-coding upstream 4922 6624821 ~ 6625104 (-)
G233687 NA non-coding upstream 5889 6625788 ~ 6625906 (-)
G233694 NA non-coding upstream 40641 6660540 ~ 6660745 (-)
G233704 NA non-coding upstream 51453 6671352 ~ 6671552 (-)
G233709 NA non-coding upstream 61580 6681479 ~ 6681940 (-)
G232274 NA other downstream 1410434 5206199 ~ 5209240 (-)
CI01000054_04671351_04681181 PEF1 other downstream 1947441 4670151 ~ 4681361 (-)
G231645 NA other downstream 2636851 3981847 ~ 3982823 (-)
G230908 NA other downstream 3556331 3057648 ~ 3063343 (-)
CI01000054_02857402_02860451 NA other downstream 3759101 2857402 ~ 2860573 (-)
CI01000054_07165957_07169539 HEYL other upstream 545536 7165435 ~ 7169539 (-)
G235216 NA other upstream 2628140 9248039 ~ 9248538 (-)
CI01000054_09483912_09484282 MRPL36 other upstream 2863248 9483147 ~ 9484282 (-)
CI01000054_09864693_09866871 PPP1R11 other upstream 3243422 9863321 ~ 9867212 (-)

Expression



Co-expression Network