G232761


Basic Information

Item Value
gene id G232761
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 6625383 ~ 6625685 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU264124
CCAGTCCATTTGTCACCCAAAGCTACAGCGCCATAGAACGCAAACGCCTGGCAGGCTCTGCTAAGGTCACGGTAAACGCCGCCTCAGTAGCACCTGATTAATTCCAATGTAAAGGCGTGGAAATAAAATTCAATTGATCATTTCCAATTAGCCAGGATCTCTGGGATGACAAGGCAGCCAAGGTCGTGGAACCTTTTGTAGAGCACGTTAATTACAGCGCACCATGTAAGGACTTCTTGAGATCTTATAACAGGCAGCGTGTCAGAAATCGATACAAATGTTGCAGGAAATGTACCATAGATC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU264124 True 303 lncRNA 0.46 1 6625383 6625685

Neighbor

gene id symbol gene type direction distance location
CI01000054_06437628_06441214 NA coding upstream 183902 6437628 ~ 6441481 (+)
CI01000054_06434217_06435680 OTUD6B coding upstream 189703 6433756 ~ 6435680 (+)
CI01000054_06411594_06411984 NA coding upstream 212862 6411594 ~ 6412521 (+)
CI01000054_06305908_06312122 NA coding upstream 313220 6305908 ~ 6312163 (+)
CI01000054_06292147_06297237 NA coding upstream 327823 6291976 ~ 6297560 (+)
CI01000054_06756071_06757443 NA coding downstream 130124 6755809 ~ 6757514 (+)
CI01000054_06759472_06761310 NA coding downstream 133126 6758811 ~ 6761310 (+)
CI01000054_06789505_06789810 NA coding downstream 162677 6788362 ~ 6789946 (+)
CI01000054_06795526_06796596 TRIB1 coding downstream 169841 6795526 ~ 6796644 (+)
CI01000054_06865381_06869404 KLHL38A, KLHL38 coding downstream 239696 6865381 ~ 6869942 (+)
G232760 NA non-coding upstream 318 6624836 ~ 6625065 (+)
G232758 NA non-coding upstream 2166 6622915 ~ 6623217 (+)
G232756 NA non-coding upstream 3760 6621387 ~ 6621623 (+)
G232755 NA non-coding upstream 6572 6618578 ~ 6618811 (+)
G232752 NA non-coding upstream 9475 6615686 ~ 6615908 (+)
G232762 NA non-coding downstream 229 6625914 ~ 6626226 (+)
G232694 NA non-coding downstream 2608 6628293 ~ 6629575 (+)
G232788 NA non-coding downstream 53253 6678938 ~ 6679176 (+)
G232792 NA non-coding downstream 60521 6686206 ~ 6686781 (+)
G232794 NA non-coding downstream 82940 6708625 ~ 6708970 (+)
G232659 NA other upstream 249489 6374850 ~ 6375894 (+)
G232558 NA other upstream 583520 5993660 ~ 6041863 (+)
CI01000054_05608892_05634793 RNF19B other upstream 1000708 5608457 ~ 5634804 (+)
G231863 NA other upstream 2174653 4407152 ~ 4450730 (+)
G232870 NA other downstream 262227 6887912 ~ 6888503 (+)
G233024 NA other downstream 941838 7567523 ~ 7609893 (+)
G233306 NA other downstream 1678914 8304599 ~ 8304949 (+)
CI01000054_08325126_08329621 HPCAL4, VSNL1, VSNL1.S other downstream 1680252 8325126 ~ 8329716 (+)
G235560 NA other downstream 3762451 10388136 ~ 10392378 (+)

Expression


Co-expression Network