G232944


Basic Information

Item Value
gene id G232944
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 7178248 ~ 7178633 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU264351
AGTCAATGTAGTGGAATAAAAACAACGCCTAGTCTTTTTCACTGCAACTTCAAAGGAAGCTAGACAATGTTGTTGAAACTAGCGCTGGATATCTGAGGTAATTATATGTTACACTGTTTGCTAGCCTGGCATAATGATCTCATCGTATACTTCTCATCATTTATTCTGAGGGTATATGACTGATTGTTTTCCATATATCCATTTTCTTTAAAGTATATTTGAAAAGGGGGTTTGACTTGTCAAACAGTGGTGGCTTTTTCTGGACCTAGGCTATCTCCGCAAGGTCGTCTGCCATTTTAAATGCGCGAGCCCTTAAATTAGAATGGATTCTGATTGGCTGTCAGTGTTTTATCGTTCAATAGCTGGAAAAAAAATCATTTTGAAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU264351 True 386 lncRNA 0.37 1 7178248 7178633

Neighbor

gene id symbol gene type direction distance location
CI01000054_07145831_07153505 NA coding upstream 23594 7145505 ~ 7154654 (+)
CI01000054_07119711_07124720 HPCA.S, HPCAL1, HPCA, HPCAL1.L coding upstream 53478 7119711 ~ 7124770 (+)
CI01000054_07040367_07056299 5NT1A, NT5C1AA coding upstream 120678 7040367 ~ 7057570 (+)
CI01000054_07019424_07021726 NA coding upstream 155937 7019424 ~ 7022311 (+)
CI01000054_07011099_07011947 NA coding upstream 166150 7011023 ~ 7012098 (+)
CI01000054_07189617_07192052 ZBTB8B coding downstream 9344 7187977 ~ 7192069 (+)
CI01000054_07193147_07196114 FUCA1.1, FUCA1.2 coding downstream 14514 7193147 ~ 7196219 (+)
CI01000054_07198599_07202146 FUCA1.1, FUCA1.2 coding downstream 19966 7198599 ~ 7202293 (+)
CI01000054_07209423_07216395 GMPR coding downstream 30790 7209423 ~ 7217210 (+)
CI01000054_07240475_07241355 NA coding downstream 61790 7240423 ~ 7242458 (+)
G232942 NA non-coding upstream 1673 7176339 ~ 7176575 (+)
G232914 NA non-coding upstream 110595 7067414 ~ 7067653 (+)
G232848 NA non-coding upstream 169025 7007111 ~ 7009223 (+)
G232886 NA non-coding upstream 174274 7003611 ~ 7003974 (+)
G232883 NA non-coding upstream 232415 6945630 ~ 6945833 (+)
G232948 NA non-coding downstream 3269 7181902 ~ 7182155 (+)
G232907 NA non-coding downstream 39506 7218139 ~ 7219649 (+)
G232904 NA non-coding downstream 121047 7299680 ~ 7330015 (+)
G233034 NA non-coding downstream 168170 7346803 ~ 7347003 (+)
G233010 NA non-coding downstream 183570 7362203 ~ 7387184 (+)
G232870 NA other upstream 289745 6887912 ~ 6888503 (+)
G232659 NA other upstream 802354 6374850 ~ 6375894 (+)
CI01000054_06305908_06312122 NA other upstream 871388 6305908 ~ 6312163 (+)
G232558 NA other upstream 1136385 5993660 ~ 6041863 (+)
CI01000054_05608892_05634793 RNF19B other upstream 1553573 5608457 ~ 5634804 (+)
G233024 NA other downstream 388890 7567523 ~ 7609893 (+)
G233306 NA other downstream 1125966 8304599 ~ 8304949 (+)
CI01000054_08325126_08329621 HPCAL4, VSNL1, VSNL1.S other downstream 1127304 8325126 ~ 8329716 (+)
G235560 NA other downstream 3209503 10388136 ~ 10392378 (+)
CI01000054_11564820_11568338 S100V2 other downstream 4386343 11564820 ~ 11568999 (+)

Expression


Co-expression Network