G233053


Basic Information

Item Value
gene id G233053
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 7390578 ~ 7390894 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU264464
ACAAATATTTTATTACACATCCACGCACATATAAATACATAATACAGAATACACTACTTCTTGTCTCCTGCTTTAGCCTGAGGATCTTTAGCACTGCAGCGGGTCTGTAAGGCTGAGAGCATTTCTTGGGTGGTTAATTTGGATCCCTTCATCACCAGCCTCTCTCCATCCAAGAATGTGATGTCAATCGTAGGCTCTGATCGGTCGTGCTTTACTTCTGTGATAACTTCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU264464 True 232 lncRNA 0.42 2 7390578 7390894

Neighbor

gene id symbol gene type direction distance location
CI01000054_07271120_07280248 NA coding upstream 110213 7270906 ~ 7280365 (+)
CI01000054_07252016_07252204 NA coding upstream 138161 7251801 ~ 7252417 (+)
CI01000054_07240475_07241355 NA coding upstream 148120 7240423 ~ 7242458 (+)
CI01000054_07209423_07216395 GMPR coding upstream 173368 7209423 ~ 7217210 (+)
CI01000054_07198599_07202146 FUCA1.1, FUCA1.2 coding upstream 188285 7198599 ~ 7202293 (+)
CI01000054_07438245_07449632 PAG1 coding downstream 46538 7437432 ~ 7449712 (+)
CI01000054_07454627_07503082 ZNF704 coding downstream 63733 7454627 ~ 7503082 (+)
CI01000054_07539134_07556858 ZBTB10 coding downstream 148240 7539134 ~ 7558395 (+)
CI01000054_07582152_07584554 NA coding downstream 191086 7581980 ~ 7584692 (+)
CI01000054_07599184_07601743 HEY1 coding downstream 207012 7597906 ~ 7603125 (+)
G233051 NA non-coding upstream 1001 7389362 ~ 7389577 (+)
G233050 NA non-coding upstream 1230 7389144 ~ 7389348 (+)
G233010 NA non-coding upstream 3394 7362203 ~ 7387184 (+)
G233034 NA non-coding upstream 43575 7346803 ~ 7347003 (+)
G232904 NA non-coding upstream 60563 7299680 ~ 7330015 (+)
G233065 NA non-coding downstream 29534 7420428 ~ 7421357 (+)
G233017 NA non-coding downstream 117872 7508766 ~ 7513700 (+)
G233018 NA non-coding downstream 123510 7514404 ~ 7516606 (+)
G233096 NA non-coding downstream 340961 7731855 ~ 7732104 (+)
G233025 NA non-coding downstream 343927 7734821 ~ 7736502 (+)
G232870 NA other upstream 502075 6887912 ~ 6888503 (+)
G232659 NA other upstream 1014684 6374850 ~ 6375894 (+)
CI01000054_06305908_06312122 NA other upstream 1083718 6305908 ~ 6312163 (+)
G232558 NA other upstream 1348715 5993660 ~ 6041863 (+)
CI01000054_05608892_05634793 RNF19B other upstream 1765903 5608457 ~ 5634804 (+)
G233024 NA other downstream 176629 7567523 ~ 7609893 (+)
G233306 NA other downstream 913705 8304599 ~ 8304949 (+)
CI01000054_08325126_08329621 HPCAL4, VSNL1, VSNL1.S other downstream 915043 8325126 ~ 8329716 (+)
G235560 NA other downstream 2997242 10388136 ~ 10392378 (+)
CI01000054_11564820_11568338 S100V2 other downstream 4174082 11564820 ~ 11568999 (+)

Expression


Co-expression Network