G234025


Basic Information

Item Value
gene id G234025
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 7567234 ~ 7567509 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU265521
CATCATTTAATCACATTTATGTCTTCCCAAACTATTACCTACAGAAGTCTGTTACTGATCTATTATTTACTATTAAAACACTGCTGTAAATGTGTATATACTCAAACTATCTTCATTTCAGAAAGCTTAAATTTGCATTATTCAAACCATTAAATCCTGGGTTTGTGGTTTTTATACTAATACTTGTACATTATATTTCAAGCCATACAATAGTTTTGTGTGAGGAACAAGACTTTATTTCGTGAAACACTAATTCAGGAGTTTTTAAGCTTGAAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU265521 True 276 lncRNA 0.29 1 7567234 7567509

Neighbor

gene id symbol gene type direction distance location
CI01000054_07516390_07526784 TPD52 coding downstream 39785 7516167 ~ 7527449 (-)
CI01000054_07418471_07418846 NA coding downstream 148381 7418167 ~ 7418853 (-)
CI01000054_07398765_07399272 NA coding downstream 167180 7398554 ~ 7400054 (-)
CI01000054_07390631_07391977 MRPL53 coding downstream 174131 7390586 ~ 7393103 (-)
CI01000054_07385840_07388475 PMP2, FABP11A, FABPH coding downstream 177817 7385792 ~ 7389417 (-)
CI01000054_07607425_07611037 STMN2A, STMN2B, STMN2 coding upstream 38991 7606500 ~ 7611037 (-)
CI01000054_07642350_07658894 NA coding upstream 74291 7641800 ~ 7660515 (-)
CI01000054_07712126_07718933 GMNN coding upstream 144526 7712035 ~ 7718933 (-)
CI01000054_07723457_07725732 ACOT13 coding upstream 155899 7723408 ~ 7725732 (-)
CI01000054_07737375_07747797 TMEM64 coding upstream 169745 7737254 ~ 7747797 (-)
G234024 NA non-coding downstream 48 7566956 ~ 7567186 (-)
G234023 NA non-coding downstream 709 7566239 ~ 7566525 (-)
G233942 NA non-coding downstream 57576 7508368 ~ 7509658 (-)
G233922 NA non-coding downstream 229118 7337904 ~ 7338116 (-)
G233904 NA non-coding downstream 340389 7220031 ~ 7226845 (-)
G234042 NA non-coding upstream 62068 7629577 ~ 7630828 (-)
G234039 NA non-coding upstream 65493 7633002 ~ 7634751 (-)
G234057 NA non-coding upstream 69993 7637502 ~ 7637975 (-)
G234071 NA non-coding upstream 133366 7700875 ~ 7704166 (-)
G234097 NA non-coding upstream 138587 7706096 ~ 7707359 (-)
CI01000054_07165957_07169539 HEYL other downstream 395561 7165435 ~ 7169539 (-)
CI01000054_06629482_06641861 TRIQK other downstream 913221 6628082 ~ 6642160 (-)
G232274 NA other downstream 2357994 5206199 ~ 5209240 (-)
CI01000054_04671351_04681181 PEF1 other downstream 2895001 4670151 ~ 4681361 (-)
G231645 NA other downstream 3584411 3981847 ~ 3982823 (-)
G235216 NA other upstream 1680530 9248039 ~ 9248538 (-)
CI01000054_09483912_09484282 MRPL36 other upstream 1915638 9483147 ~ 9484282 (-)
CI01000054_09864693_09866871 PPP1R11 other upstream 2295812 9863321 ~ 9867212 (-)
CI01000054_10817235_10819181 TAC1 other upstream 3236362 10816015 ~ 10819362 (-)
CI01000054_10872970_10881017 SDHAF3 other upstream 3303595 10871104 ~ 10881495 (-)

Expression


Co-expression Network