G234385


Basic Information

Item Value
gene id G234385
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 8486944 ~ 8487154 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU265916
GCCAAATTGTCCCCCCCATTATTTGAAATTCCCGCTGCACTTTATTATGCAGCACACTGTATTTTGTTAGGATGACAAAAAGGTTTAAATGTTACATTTTTAGTCTGGTGACTGATCTGCCTCAGCAGTCTAACAGCGCTCGTCAATGTCAAAATGATTGAGATGGCCAATCAAATCAAAGTAGGCGGGTTTACTGTTCACCGAAGCAGAG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU265916 True 211 lncRNA 0.42 1 8486944 8487154

Neighbor

gene id symbol gene type direction distance location
CI01000054_08425960_08439362 NA coding downstream 47514 8425943 ~ 8439430 (-)
CI01000054_08400578_08406066 NA coding downstream 80878 8400531 ~ 8406066 (-)
CI01000054_08375424_08376756 NA coding downstream 109964 8375071 ~ 8376980 (-)
CI01000054_08353876_08358232 NA coding downstream 128712 8353376 ~ 8358232 (-)
CI01000054_08272679_08293481 NA coding downstream 191779 8272519 ~ 8295165 (-)
CI01000054_08574533_08590975 NA coding upstream 87326 8574480 ~ 8591292 (-)
CI01000054_08652832_08667152 NA coding upstream 165635 8652789 ~ 8668929 (-)
CI01000054_08692653_08694052 NA coding upstream 204985 8692139 ~ 8694052 (-)
CI01000054_08710955_08718087 HDAC1, HDAC2.S, HDAC2, HDAC1.S coding upstream 223633 8710787 ~ 8718087 (-)
CI01000054_08721571_08723333 NA coding upstream 233854 8721008 ~ 8724208 (-)
G234383 NA non-coding downstream 1043 8485682 ~ 8485901 (-)
G234378 NA non-coding downstream 9989 8476733 ~ 8476955 (-)
G234367 NA non-coding downstream 24855 8461769 ~ 8462089 (-)
G234366 NA non-coding downstream 26172 8460553 ~ 8460772 (-)
G234365 NA non-coding downstream 27382 8459334 ~ 8459562 (-)
G234375 NA non-coding upstream 2636 8489790 ~ 8491117 (-)
G234388 NA non-coding upstream 10752 8497906 ~ 8498130 (-)
G234391 NA non-coding upstream 14147 8501301 ~ 8501529 (-)
G234393 NA non-coding upstream 16883 8504037 ~ 8504273 (-)
G234405 NA non-coding upstream 39700 8526854 ~ 8527113 (-)
CI01000054_07165957_07169539 HEYL other downstream 1315271 7165435 ~ 7169539 (-)
CI01000054_06629482_06641861 TRIQK other downstream 1832931 6628082 ~ 6642160 (-)
G232274 NA other downstream 3277704 5206199 ~ 5209240 (-)
CI01000054_04671351_04681181 PEF1 other downstream 3814711 4670151 ~ 4681361 (-)
G231645 NA other downstream 4504121 3981847 ~ 3982823 (-)
G235216 NA other upstream 760885 9248039 ~ 9248538 (-)
CI01000054_09483912_09484282 MRPL36 other upstream 995993 9483147 ~ 9484282 (-)
CI01000054_09864693_09866871 PPP1R11 other upstream 1376167 9863321 ~ 9867212 (-)
CI01000054_10817235_10819181 TAC1 other upstream 2316717 10816015 ~ 10819362 (-)
CI01000054_10872970_10881017 SDHAF3 other upstream 2383950 10871104 ~ 10881495 (-)

Expression


Co-expression Network