G234661


Basic Information

Item Value
gene id G234661
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 9097717 ~ 9098004 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU266203
TGACTTCGTCGTAGAAGAGTCCGGGTGCTGAATTGGCCTGCCTGAAGTCCAGATCTTTCACCTATAGAGAACATTTGGCTCATCATTAAACGAAAAATACATCAAAGATGACCACAAACTCTTCAGCAGCTGGAAACCTATATCAGGCAAGAATGGGACCAAATTCCAACCTCAAAACTCCAGAAACTCATAACCTCAATGCCCAGACGTCTTCAAACTGTTTTGAAAAGAAGAGGAGATGCTACACCATAGTAAACATGCCCCCGTCCCAACTATTTTGAGACCTGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU266203 True 288 lncRNA 0.43 1 9097717 9098004

Neighbor

gene id symbol gene type direction distance location
CI01000054_08975450_08984634 E2F3 coding upstream 112542 8975359 ~ 8985175 (+)
CI01000054_08969979_08973590 NA coding upstream 124051 8969979 ~ 8973666 (+)
CI01000054_08908112_08917294 FNDC5B, FNDC5, FNDC5A coding upstream 180122 8908112 ~ 8917595 (+)
CI01000054_08771624_08790335 NA coding upstream 306795 8771561 ~ 8790922 (+)
CI01000054_08725294_08727378 NA coding upstream 369887 8725164 ~ 8727830 (+)
CI01000054_09151300_09164780 NA coding downstream 52781 9150785 ~ 9164938 (+)
CI01000054_09232327_09233391 SOX4A, SOX4 coding downstream 133995 9231999 ~ 9234242 (+)
CI01000054_09437674_09440443 NA coding downstream 338339 9436343 ~ 9441827 (+)
CI01000054_09485610_09487896 NDUFS6 coding downstream 387237 9485241 ~ 9487967 (+)
CI01000054_09556901_09561363 IRX1, IRX1B coding downstream 458273 9556277 ~ 9561580 (+)
G234652 NA non-coding upstream 8682 9088750 ~ 9089035 (+)
G234643 NA non-coding upstream 20920 9076572 ~ 9076797 (+)
G234641 NA non-coding upstream 21800 9075708 ~ 9075917 (+)
G234636 NA non-coding upstream 29810 9067578 ~ 9067907 (+)
G234588 NA non-coding upstream 123040 8974009 ~ 8974677 (+)
G234723 NA non-coding downstream 71609 9169613 ~ 9169822 (+)
G234725 NA non-coding downstream 73736 9171740 ~ 9171976 (+)
G234745 NA non-coding downstream 105713 9203717 ~ 9203965 (+)
G234748 NA non-coding downstream 111067 9209071 ~ 9210518 (+)
G234749 NA non-coding downstream 112690 9210694 ~ 9210940 (+)
CI01000054_08325126_08329621 HPCAL4, VSNL1, VSNL1.S other upstream 768129 8325126 ~ 8329716 (+)
G233306 NA other upstream 792768 8304599 ~ 8304949 (+)
G233024 NA other upstream 1487824 7567523 ~ 7609893 (+)
G232870 NA other upstream 2209214 6887912 ~ 6888503 (+)
G232659 NA other upstream 2721823 6374850 ~ 6375894 (+)
G235560 NA other downstream 1290132 10388136 ~ 10392378 (+)
CI01000054_11564820_11568338 S100V2 other downstream 2466972 11564820 ~ 11568999 (+)
CI01000054_11633235_11635069 PRF1.8 other downstream 2534972 11632959 ~ 11635103 (+)
CI01000054_11648262_11648786 NA other downstream 2549975 11647959 ~ 11649495 (+)
G236874 NA other downstream 2715684 11813688 ~ 11816475 (+)

Expression


Co-expression Network