G236506


Basic Information

Item Value
gene id G236506
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 10772245 ~ 10824773 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU268210
GTTTTTTATAGGGTACAGAGCAGAATTTAATTTATTAATCCATGAAAATATGATAAATCCGGCTTCTCTCCGTGAAGGCGCGCACTCATTTCAAATGTCAATCCACTGAAACACGGCATGTCGCAATCTGTGACGAAGCAGGTGAGAACCAATGAGCGTTCGATATCAGTGCCGTAAACCATGTCGTAACGCTTCTCGAGGGTGGCGCTACTTTCAAATTTGAATCATAACGAGCGCGAGCTTTGACTGTGACGGTCGCTGTTGCTGAGAATGAATATGAAGA

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU268210 True 283 lncRNA 0.44 2 10772245 10824773

Neighbor

gene id symbol gene type direction distance location
CI01000054_10645438_10672411 NA coding downstream 99564 10645142 ~ 10672681 (-)
CI01000054_10518872_10568706 JARID2B, JARID2 coding downstream 203539 10518872 ~ 10568706 (-)
CI01000054_10389232_10412773 MYLIPA, MYLIP coding downstream 359472 10389232 ~ 10412773 (-)
CI01000054_10269355_10363708 NPR1B, NPR1, NPR1A coding downstream 408096 10268720 ~ 10364149 (-)
CI01000054_10248885_10261371 INTS3 coding downstream 510874 10248601 ~ 10261371 (-)
CI01000054_10872970_10881017 SDHAF3 coding upstream 48042 10871104 ~ 10881495 (-)
CI01000054_10910820_10938477 COL28A1 coding upstream 85601 10910374 ~ 10938477 (-)
CI01000054_10949424_10950271 RPA3 coding upstream 124546 10949319 ~ 10951456 (-)
CI01000054_11097818_11099299 NA coding upstream 272935 11097708 ~ 11099334 (-)
CI01000054_11184013_11193925 EYA3, EYA2 coding upstream 358957 11183730 ~ 11193925 (-)
G236480 NA non-coding downstream 33397 10738542 ~ 10738848 (-)
G236384 NA non-coding downstream 143935 10616969 ~ 10628310 (-)
G236387 NA non-coding downstream 169291 10570225 ~ 10602954 (-)
G236394 NA non-coding downstream 260816 10474070 ~ 10511429 (-)
G236383 NA non-coding downstream 317129 10454828 ~ 10455116 (-)
G236533 NA non-coding upstream 23515 10848288 ~ 10848555 (-)
G236542 NA non-coding upstream 43014 10867787 ~ 10867998 (-)
G236551 NA non-coding upstream 70158 10894931 ~ 10895319 (-)
G236554 NA non-coding upstream 73694 10898467 ~ 10898951 (-)
G236555 NA non-coding upstream 78359 10903132 ~ 10904729 (-)
CI01000054_09864693_09866871 PPP1R11 other downstream 905033 9863321 ~ 9867212 (-)
CI01000054_09483912_09484282 MRPL36 other downstream 1286858 9483147 ~ 9484282 (-)
G235216 NA other downstream 1523707 9248039 ~ 9248538 (-)
CI01000054_07165957_07169539 HEYL other downstream 3600572 7165435 ~ 7169539 (-)
CI01000054_06629482_06641861 TRIQK other downstream 4118232 6628082 ~ 6642160 (-)
G236748 NA other upstream 460421 11285194 ~ 11295784 (-)
CI01000054_11780397_11781842 SNAPIN other upstream 954117 11778890 ~ 11781880 (-)

Expression


Co-expression Network