G236848


Basic Information

Item Value
gene id G236848
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 11614637 ~ 11614917 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU268613
GATGGGCAGAGGATCACCAATTCCCCCAATGCTGCGGCGAAAAATAGTGGAGCAATATCAGAAAGGAGTTTCTCAGAGAAAAATTGCAAAGAGTTTGAAGTTATCATCATCTACAGTGCATAATATCATCCAAAGTTTCAGGGAATCTGGAACAATCTCTGTGCGTAAGGGTCAAGGCCGGAAAACCGTACTGGATGCCTGTGATTTTTGGGCCCTTAGATGGCACTGCATCACATACAGGAATGCTACTGTAATGGAAATCACAACATGAGCTCAGGAAT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU268613 True 281 lncRNA 0.44 1 11614637 11614917

Neighbor

gene id symbol gene type direction distance location
CI01000054_11600741_11608257 NA coding upstream 6275 11600506 ~ 11608390 (+)
CI01000054_11564820_11568338 S100V2 coding upstream 46187 11564820 ~ 11568999 (+)
CI01000054_11536181_11537063 NA coding upstream 77473 11534757 ~ 11537164 (+)
CI01000054_11409512_11412290 TXNIP, TXNIPA coding upstream 201506 11409254 ~ 11413131 (+)
CI01000054_11289604_11337266 NA coding upstream 277257 11289604 ~ 11337380 (+)
CI01000054_11633235_11635069 PRF1.8 coding downstream 18042 11632959 ~ 11635103 (+)
CI01000054_11637464_11637950 NA coding downstream 22416 11637333 ~ 11638191 (+)
CI01000054_11648262_11648786 NA coding downstream 33042 11647959 ~ 11649495 (+)
CI01000054_11659093_11663413 THAP7 coding downstream 44176 11659093 ~ 11663607 (+)
CI01000054_11666236_11693431 NA coding downstream 51319 11666236 ~ 11693479 (+)
G236822 NA non-coding upstream 17119 11597266 ~ 11597518 (+)
G236373 NA non-coding upstream 63941 11549604 ~ 11550696 (+)
G236362 NA non-coding upstream 106733 11507425 ~ 11507904 (+)
G236305 NA non-coding upstream 241041 11369095 ~ 11373596 (+)
G236849 NA non-coding downstream 1910 11616827 ~ 11617146 (+)
G236851 NA non-coding downstream 7688 11622605 ~ 11622853 (+)
G236852 NA non-coding downstream 13369 11628286 ~ 11628516 (+)
G236853 NA non-coding downstream 13790 11628707 ~ 11629027 (+)
G236857 NA non-coding downstream 24987 11639904 ~ 11640550 (+)
G235560 NA other upstream 1222259 10388136 ~ 10392378 (+)
CI01000054_08325126_08329621 HPCAL4, VSNL1, VSNL1.S other upstream 3285049 8325126 ~ 8329716 (+)
G233306 NA other upstream 3309688 8304599 ~ 8304949 (+)
G233024 NA other upstream 4004744 7567523 ~ 7609893 (+)
G236874 NA other downstream 198771 11813688 ~ 11816475 (+)
CI01000054_12887165_12901376 NA other downstream 1269985 12886994 ~ 12902006 (+)

Expression


Co-expression Network