G237069


Basic Information

Item Value
gene id G237069
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000054
NCBI id null
chromosome length 13006764
location 12400544 ~ 12400783 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU268882
ATAACGTATACAGCTACATTTGAGGAAGAGTGAAAACTCTTTACATGTGCTCGCGCTCATAACCTCTGAACATCTGAACACAATGATCAAATGCACATTGACGGATCTTCTTCCGTCTGTTCTCCAAAATGTAATCAAATGTATATTTCTGCAGGCGCGTGTAAACTGGTTAACGTTAATTTTCAAGACAAACAGGTTGCCCGGCGCCGCCACTGCGCTACCCATAAATTATCGCGGGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU268882 True 240 lncRNA 0.43 1 12400544 12400783

Neighbor

gene id symbol gene type direction distance location
CI01000054_12321079_12339203 LRCH3 coding upstream 61341 12321079 ~ 12339203 (+)
CI01000054_12318711_12319755 SERP2, SERP1, SERP1.S coding upstream 80574 12318312 ~ 12320602 (+)
CI01000054_12296634_12299462 NA coding upstream 100996 12296634 ~ 12299548 (+)
CI01000054_12191048_12211237 GDPD4A, GDPD4 coding upstream 189307 12189522 ~ 12211237 (+)
CI01000054_12142398_12166344 PAK1 coding upstream 233545 12142398 ~ 12166999 (+)
CI01000054_12524575_12697096 UNC13C coding downstream 123792 12524575 ~ 12697096 (+)
CI01000054_12811634_12819065 NA coding downstream 410851 12811634 ~ 12819280 (+)
CI01000054_12846104_12850954 NA coding downstream 444395 12845178 ~ 12851346 (+)
CI01000054_12887165_12901376 NA coding downstream 486290 12886994 ~ 12902006 (+)
CI01000054_12982344_12998857 NA coding downstream 580146 12980767 ~ 12999175 (+)
G237068 NA non-coding upstream 440 12399728 ~ 12400104 (+)
G237067 NA non-coding upstream 1790 12398491 ~ 12398754 (+)
G237066 NA non-coding upstream 4561 12395655 ~ 12395983 (+)
G237063 NA non-coding upstream 6751 12393579 ~ 12393793 (+)
G237052 NA non-coding upstream 19797 12380431 ~ 12380747 (+)
G237072 NA non-coding downstream 19595 12420378 ~ 12420785 (+)
G237075 NA non-coding downstream 26255 12427038 ~ 12427413 (+)
G237369 NA non-coding downstream 38586 12439369 ~ 12439587 (+)
G237376 NA non-coding downstream 211239 12612022 ~ 12613528 (+)
G237374 NA non-coding downstream 217739 12618522 ~ 12629743 (+)
G236874 NA other upstream 584069 11813688 ~ 11816475 (+)
CI01000054_11648262_11648786 NA other upstream 751519 11647959 ~ 11649495 (+)
CI01000054_11633235_11635069 PRF1.8 other upstream 766480 11632959 ~ 11635103 (+)
CI01000054_11564820_11568338 S100V2 other upstream 831545 11564820 ~ 11568999 (+)
G235560 NA other upstream 2008166 10388136 ~ 10392378 (+)

Expression


Co-expression Network