G246298


Basic Information

Item Value
gene id G246298
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 3616182 ~ 3616793 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU279533
AAAGTTCAGTGAGAGGCTGTGCAAAAGTGTCCAGTACTAGCTTGATCTCGGACCACAGCTCATTGGACTTAAACTCATGGCGATATCTTTTTAAAAAGGGAATGCGCTGTGCGAAGAATTCCATTGATGATGTGGAAGTCTCCGCTCTGAAAGCGGTTCACCATCTCGGTCAGGAGATCCGGCCATTTCTGAGGAAAGTCCTCTCGCCCGATGATGCT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU279533 True 218 lncRNA 0.48 2 3616182 3616793

Neighbor

gene id symbol gene type direction distance location
CI01000057_03428989_03429249 NA coding downstream 185808 3428672 ~ 3430374 (-)
CI01000057_03345268_03367172 NA coding downstream 248172 3344746 ~ 3368010 (-)
CI01000057_03192667_03213688 NA coding downstream 402313 3192502 ~ 3213869 (-)
CI01000057_03027103_03027612 NA coding downstream 588331 3027080 ~ 3027851 (-)
CI01000057_02844117_02844398 NA coding downstream 769444 2843791 ~ 2846738 (-)
CI01000057_03629306_03634635 NA coding upstream 12133 3628504 ~ 3634635 (-)
CI01000057_03847471_03851892 GAMT coding upstream 230512 3847305 ~ 3852121 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 coding upstream 270410 3887203 ~ 3892054 (-)
CI01000057_03903266_03927695 ANO8, ANO8B coding upstream 285356 3902149 ~ 3927695 (-)
CI01000057_03964894_03967760 PLVAP coding upstream 347662 3964455 ~ 3968737 (-)
G246251 NA non-coding downstream 10325 3605618 ~ 3605857 (-)
G246250 NA non-coding downstream 11502 3604450 ~ 3604680 (-)
G245967 NA non-coding downstream 12986 3600603 ~ 3603196 (-)
G246248 NA non-coding downstream 20545 3595345 ~ 3595637 (-)
G245973 NA non-coding downstream 24585 3590792 ~ 3591597 (-)
G246316 NA non-coding upstream 19165 3635958 ~ 3636175 (-)
G246297 NA non-coding upstream 20534 3637327 ~ 3661133 (-)
G246334 NA non-coding upstream 62891 3679684 ~ 3679883 (-)
G246338 NA non-coding upstream 65478 3682271 ~ 3682835 (-)
CI01000057_01904867_01921400 NA other downstream 1694761 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other downstream 1811029 1801528 ~ 1806454 (-)
G244358 NA other downstream 3045154 570530 ~ 571028 (-)
CI01000057_04927533_04931127 CDK4 other upstream 1311951 4927533 ~ 4931420 (-)
G246780 NA other upstream 1594317 5086312 ~ 5283617 (-)
CI01000057_05925181_05926068 NA other upstream 2306747 5923540 ~ 5927295 (-)

Expression


Co-expression Network