G246407


Basic Information

Item Value
gene id G246407
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000057
NCBI id null
chromosome length 6014843
location 3991561 ~ 3991876 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU279660
AGTTAAGGCTGTGCGCGGAGACTCCAATGTATCCTATCTAGCAATGATACAGTATGTTATTGGAAGGGTTAGTTCACCCAAACACTATCAAGATCCAAAAAAGCACTATAAAAGTGGTCAGCATGTCCATATGAACAAGCCATACAATAGCTGTATGTGAACAGACCAAAGTTTAAGCCACTATTGTTTAAAAGTCTCTGCTGATAGAAAATATCACTTTGGGCATTTTGCTAAATATCTCCATTTCAGTTCCATTAACGAGTTTGGAAGGAGTGTGAGTAGATGATTTCATTCATTTCTCCACCCTTTAATAGTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU279660 True 316 lncRNA 0.38 1 3991561 3991876

Neighbor

gene id symbol gene type direction distance location
CI01000057_03964894_03967760 PLVAP coding downstream 22824 3964455 ~ 3968737 (-)
CI01000057_03903266_03927695 ANO8, ANO8B coding downstream 63866 3902149 ~ 3927695 (-)
CI01000057_03887278_03892054 ABHD8B, ABHD8 coding downstream 99507 3887203 ~ 3892054 (-)
CI01000057_03847471_03851892 GAMT coding downstream 139440 3847305 ~ 3852121 (-)
CI01000057_03629306_03634635 NA coding downstream 356926 3628504 ~ 3634635 (-)
CI01000057_03995084_03999126 NA coding upstream 2014 3993890 ~ 3999163 (-)
CI01000057_04042903_04046286 CCL44 coding upstream 50894 4042770 ~ 4046320 (-)
CI01000057_04055321_04058726 POLE4 coding upstream 63415 4055291 ~ 4059069 (-)
CI01000057_04145896_04146600 NRTN coding upstream 153388 4145264 ~ 4146790 (-)
CI01000057_04195849_04198909 NDUFA11 coding upstream 203919 4195795 ~ 4198909 (-)
G246278 NA non-coding downstream 175218 3815644 ~ 3816343 (-)
G246295 NA non-coding downstream 176001 3814101 ~ 3815560 (-)
G246363 NA non-coding downstream 226859 3764262 ~ 3764702 (-)
G246342 NA non-coding downstream 266837 3719901 ~ 3724724 (-)
G246429 NA non-coding upstream 69747 4061623 ~ 4140129 (-)
G246279 NA non-coding upstream 203148 4195024 ~ 4195559 (-)
G246281 NA non-coding upstream 216087 4207963 ~ 4208933 (-)
G246474 NA non-coding upstream 217481 4209357 ~ 4209730 (-)
G246488 NA non-coding upstream 255648 4247524 ~ 4247797 (-)
CI01000057_01904867_01921400 NA other downstream 2070140 1904533 ~ 1921905 (-)
CI01000057_01801708_01806454 LHFPL5, LHFPL5A other downstream 2186408 1801528 ~ 1806454 (-)
G244358 NA other downstream 3420533 570530 ~ 571028 (-)
CI01000057_04927533_04931127 CDK4 other upstream 936868 4927533 ~ 4931420 (-)
G246780 NA other upstream 1219234 5086312 ~ 5283617 (-)
CI01000057_05925181_05926068 NA other upstream 1931664 5923540 ~ 5927295 (-)

Expression


Co-expression Network