G247155


Basic Information

Item Value
gene id G247155
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 50018 ~ 50321 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU280510
TGGACGGCACAACATTTGTGACAGACAGTCACCAAAGTTCCATGGGGAATAAAGCGCCGGTTATGTGATACCAATCGCCTCTGTGAAGTCTGTCTAATAGTGAGCTATCCCTGTTTGCTCAGTAACCACCGCATTACAAGTGGCGCCCGAACATTTTATCTCTGGCTTTGGATTTATGGAGAAGTTTACACGGATGCAGAACCGGTTTGGGACGAGTGACGCCGTAAATGCTGTAATCTTCCTCGCCGACATGCGTGAGTCTGCACGAGGCCTATTCCAGTGCGTACAGAGTGAACTGCCCGAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU280510 True 304 lncRNA 0.50 1 50018 50321

Neighbor

gene id symbol gene type direction distance location
CI01000058_00021632_00039608 NA coding upstream 10048 21480 ~ 39970 (+)
CI01000058_00104333_00105839 NA coding downstream 54012 104333 ~ 106724 (+)
CI01000058_00241253_00245763 NA coding downstream 190932 241253 ~ 246107 (+)
CI01000058_00313907_00314170 NA coding downstream 263436 313757 ~ 314670 (+)
CI01000058_00333202_00355871 PANK4 coding downstream 282719 333040 ~ 355875 (+)
CI01000058_00382692_00395743 NA coding downstream 332371 382692 ~ 395774 (+)
G247150 NA non-coding upstream 4071 45648 ~ 45947 (+)
G247160 NA non-coding downstream 1226 51547 ~ 51928 (+)
G247162 NA non-coding downstream 2062 52383 ~ 52678 (+)
G247163 NA non-coding downstream 2563 52884 ~ 53102 (+)
G247165 NA non-coding downstream 3875 54196 ~ 54638 (+)
G247176 NA non-coding downstream 11549 61870 ~ 62126 (+)
CI01000058_00435196_00437830 AGTRAP other downstream 384721 434913 ~ 455744 (+)
CI01000058_00592498_00596709 NA other downstream 542010 592331 ~ 597171 (+)
CI01000058_01280337_01289153 DNASE2B other downstream 1178288 1278592 ~ 1289874 (+)
G247940 NA other downstream 1402676 1452997 ~ 1456447 (+)
CI01000058_01794468_01800421 KISS1 other downstream 1745392 1794468 ~ 1800421 (+)

Expression


Co-expression Network