G247653


Basic Information

Item Value
gene id G247653
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 763595 ~ 763815 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU281109
TGGCAGATGAAACCTGGGGGTCGACTAGGGTTGGAAATCATAAGAAATTTTCCGGTTCCAATTCCGGTTCCATTAAAATTATTAAACAACCAATAAAAAAATAGTAGCAAGGGGAAAATGCACAATACTGTCAAGGACTCAAAGAGTCCTTTTTGTGTTTATTATACTTGTAAAATGAGTTTAACAGACTGCTAATATCAACAAATTCACTAACACTTTAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU281109 True 221 lncRNA 0.34 1 763595 763815

Neighbor

gene id symbol gene type direction distance location
CI01000058_00728698_00738214 NA coding upstream 24657 728520 ~ 738938 (+)
CI01000058_00652594_00653181 DIRAS1A, DIRAS1B, DIRAS1, DIRAS2 coding upstream 108692 652335 ~ 654903 (+)
CI01000058_00592498_00596709 NA coding upstream 166782 592331 ~ 597171 (+)
CI01000058_00548398_00567030 NWD1 coding upstream 196423 547827 ~ 567172 (+)
CI01000058_00529237_00544012 MEPD, THOP1 coding upstream 219568 529185 ~ 544027 (+)
CI01000058_00847992_00862210 NA coding downstream 83482 847297 ~ 862430 (+)
CI01000058_00870909_00930600 ADGRL2A, ADGRL2 coding downstream 107094 870909 ~ 930600 (+)
CI01000058_01239590_01240099 NA coding downstream 475687 1239502 ~ 1240300 (+)
CI01000058_01248234_01262911 PRKACBA, PRKACB coding downstream 484419 1248234 ~ 1263318 (+)
CI01000058_01266712_01271962 SAMD13 coding downstream 501938 1265753 ~ 1274437 (+)
G247641 NA non-coding upstream 8909 740848 ~ 754686 (+)
G247617 NA non-coding upstream 35767 727439 ~ 727828 (+)
G247578 NA non-coding upstream 46818 716510 ~ 716777 (+)
G247563 NA non-coding upstream 80153 683226 ~ 683442 (+)
G247337 NA non-coding upstream 256242 506308 ~ 507353 (+)
G247663 NA non-coding downstream 21210 785025 ~ 785240 (+)
G247667 NA non-coding downstream 26464 790279 ~ 790496 (+)
G247672 NA non-coding downstream 30273 794088 ~ 794313 (+)
G247683 NA non-coding downstream 43070 806885 ~ 807312 (+)
G247639 NA non-coding downstream 167189 931004 ~ 932179 (+)
CI01000058_00435196_00437830 AGTRAP other upstream 307851 434913 ~ 455744 (+)
CI01000058_01280337_01289153 DNASE2B other downstream 464794 1278592 ~ 1289874 (+)
G247940 NA other downstream 689182 1452997 ~ 1456447 (+)
CI01000058_01794468_01800421 KISS1 other downstream 1031898 1794468 ~ 1800421 (+)
G250039 NA other downstream 3930593 4694408 ~ 4697161 (+)
CI01000058_04864571_04888198 NA other downstream 4062561 4864571 ~ 4888216 (+)

Expression


Co-expression Network