G247696


Basic Information

Item Value
gene id G247696
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 936215 ~ 936445 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU281153
CATGCTTTCATTCTAGTTGTACATATTTTCATTCTACATAATCACTGTTTCAAACACAATATTATTGTAATATGTAATGAGAACATTTGGTTTAATTACCGAAACACAACAGTATGATCTTCTTTCAGTTTAGTACTTTTAACAATCAGTTCATTCAATAGCAAACAATGCAATATACTGTACGTTTCAAATCACCCTTGTTGCTGAAATAATTACAGTTACAGGTGCCAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU281153 True 231 lncRNA 0.30 1 936215 936445

Neighbor

gene id symbol gene type direction distance location
CI01000058_00870909_00930600 ADGRL2A, ADGRL2 coding upstream 5615 870909 ~ 930600 (+)
CI01000058_00847992_00862210 NA coding upstream 73785 847297 ~ 862430 (+)
CI01000058_00728698_00738214 NA coding upstream 197277 728520 ~ 738938 (+)
CI01000058_00652594_00653181 DIRAS1A, DIRAS1B, DIRAS1, DIRAS2 coding upstream 281312 652335 ~ 654903 (+)
CI01000058_00592498_00596709 NA coding upstream 339402 592331 ~ 597171 (+)
CI01000058_01239590_01240099 NA coding downstream 303057 1239502 ~ 1240300 (+)
CI01000058_01248234_01262911 PRKACBA, PRKACB coding downstream 311789 1248234 ~ 1263318 (+)
CI01000058_01266712_01271962 SAMD13 coding downstream 329308 1265753 ~ 1274437 (+)
CI01000058_01280337_01289153 DNASE2B coding downstream 342147 1278592 ~ 1289874 (+)
CI01000058_01298298_01311989 BMP7A coding downstream 361631 1298076 ~ 1313046 (+)
G247639 NA non-coding upstream 4036 931004 ~ 932179 (+)
G247683 NA non-coding upstream 128903 806885 ~ 807312 (+)
G247672 NA non-coding upstream 141902 794088 ~ 794313 (+)
G247667 NA non-coding upstream 145719 790279 ~ 790496 (+)
G247663 NA non-coding upstream 150975 785025 ~ 785240 (+)
G247705 NA non-coding downstream 30703 967148 ~ 967373 (+)
G247711 NA non-coding downstream 34194 970639 ~ 970871 (+)
G247723 NA non-coding downstream 70280 1006725 ~ 1007170 (+)
G247820 NA non-coding downstream 97670 1034115 ~ 1034346 (+)
G247821 NA non-coding downstream 103666 1040111 ~ 1040344 (+)
CI01000058_00435196_00437830 AGTRAP other upstream 480471 434913 ~ 455744 (+)
G247940 NA other downstream 516552 1452997 ~ 1456447 (+)
CI01000058_01794468_01800421 KISS1 other downstream 859268 1794468 ~ 1800421 (+)
G250039 NA other downstream 3757963 4694408 ~ 4697161 (+)
CI01000058_04864571_04888198 NA other downstream 3889931 4864571 ~ 4888216 (+)

Expression


Co-expression Network