G248152


Basic Information

Item Value
gene id G248152
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 1876979 ~ 1877182 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU281659
GATGTCAACACAGTATACAACAATACAATATATAGGGTATGATTTTACCCCCAAATCCATCGTTTCGACACAAAATGATAACTGCAAATCCATGTGTCTCTGCCTGGAGTCCAGTTGTTTCTGTGAATTGCAGCGATCCATTTGCTTCTTTTTTCTGTAGCTTTTGTCAGTCTGTAAAAATATACCTCAGATTTTGTGTCAAAG

Function

NR:

description
unnamed protein product

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU281659 True 204 lncRNA 0.37 1 1876979 1877182

Neighbor

gene id symbol gene type direction distance location
CI01000058_01838039_01842964 NA coding upstream 33749 1838039 ~ 1843230 (+)
CI01000058_01794468_01800421 KISS1 coding upstream 76558 1794468 ~ 1800421 (+)
CI01000058_01740599_01784355 PLEKHA6 coding upstream 92303 1740599 ~ 1784676 (+)
CI01000058_01625351_01664692 PIK3C2B coding upstream 211185 1625351 ~ 1665794 (+)
CI01000058_01580247_01591754 NA coding upstream 284726 1579663 ~ 1592253 (+)
CI01000058_01957358_02009847 ATP2B4 coding downstream 80176 1957358 ~ 2009847 (+)
CI01000058_02028188_02037502 MDM4 coding downstream 150967 2028149 ~ 2037628 (+)
CI01000058_02052152_02085378 NA coding downstream 174781 2051963 ~ 2085455 (+)
CI01000058_02227590_02229507 MYOG coding downstream 350236 2227418 ~ 2230021 (+)
CI01000058_02348646_02354404 TMEM183A coding downstream 471433 2348615 ~ 2355085 (+)
G248140 NA non-coding upstream 16999 1859734 ~ 1859980 (+)
G248139 NA non-coding upstream 18913 1857684 ~ 1858066 (+)
G248138 NA non-coding upstream 20451 1856310 ~ 1856528 (+)
G248135 NA non-coding upstream 25078 1851674 ~ 1851901 (+)
G248128 NA non-coding upstream 39457 1837308 ~ 1837522 (+)
G247977 NA non-coding downstream 3998 1881180 ~ 1927032 (+)
G247950 NA non-coding downstream 50040 1927222 ~ 1941268 (+)
G247991 NA non-coding downstream 121688 1998870 ~ 2003167 (+)
G247969 NA non-coding downstream 126115 2003297 ~ 2056291 (+)
G248173 NA non-coding downstream 164989 2042171 ~ 2280818 (+)
G247940 NA other upstream 420532 1452997 ~ 1456447 (+)
CI01000058_01280337_01289153 DNASE2B other upstream 588709 1278592 ~ 1289874 (+)
CI01000058_00592498_00596709 NA other upstream 1279808 592331 ~ 597171 (+)
CI01000058_00435196_00437830 AGTRAP other upstream 1421235 434913 ~ 455744 (+)
G250039 NA other downstream 2817226 4694408 ~ 4697161 (+)
CI01000058_04864571_04888198 NA other downstream 2949194 4864571 ~ 4888216 (+)

Expression


Co-expression Network