G248432


Basic Information

Item Value
gene id G248432
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 2500110 ~ 2500317 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU281961
AATGTTCCTTAATGTCAAATTGCAAAGGCTTTGTGAATCTCATCATCTACAGTGCATAACATCATCAAAAGATTCAGAGAAACTGGAGAAATCTCTGAGCGTAAGGGAAAAGGCCGAAGACCTTTATTGGATGCCCGTGGTCTTCGGGCCCTTAGACGACACTGCATCACTCATCAGCATGATTGTGTCAATGACATTACTAAATGGG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU281961 True 208 lncRNA 0.42 1 2500110 2500317

Neighbor

gene id symbol gene type direction distance location
CI01000058_02379628_02392648 NA coding upstream 107330 2378584 ~ 2392780 (+)
CI01000058_02348646_02354404 TMEM183A coding upstream 145025 2348615 ~ 2355085 (+)
CI01000058_02227590_02229507 MYOG coding upstream 270089 2227418 ~ 2230021 (+)
CI01000058_02052152_02085378 NA coding upstream 414655 2051963 ~ 2085455 (+)
CI01000058_02028188_02037502 MDM4 coding upstream 462482 2028149 ~ 2037628 (+)
CI01000058_02578534_02589495 NA coding downstream 77744 2578061 ~ 2590541 (+)
CI01000058_02592534_02600835 NA coding downstream 90876 2591193 ~ 2601755 (+)
CI01000058_02629861_02631891 NA coding downstream 129373 2629690 ~ 2632294 (+)
CI01000058_02635467_02636768 NA coding downstream 134859 2635176 ~ 2636985 (+)
CI01000058_02650808_02653235 NA coding downstream 150119 2650436 ~ 2653371 (+)
G248406 NA non-coding upstream 38562 2460916 ~ 2461548 (+)
G248405 NA non-coding upstream 40713 2459047 ~ 2459397 (+)
G248404 NA non-coding upstream 43525 2455687 ~ 2456585 (+)
G248384 NA non-coding upstream 83629 2416253 ~ 2416481 (+)
G248374 NA non-coding upstream 97987 2401863 ~ 2402123 (+)
G248516 NA non-coding downstream 173058 2673375 ~ 2673662 (+)
G248519 NA non-coding downstream 184958 2685275 ~ 2685634 (+)
G248574 NA non-coding downstream 366905 2867222 ~ 2878788 (+)
G248566 NA non-coding downstream 391034 2891351 ~ 2908197 (+)
CI01000058_01794468_01800421 KISS1 other upstream 702378 1794468 ~ 1800421 (+)
G247940 NA other upstream 1043663 1452997 ~ 1456447 (+)
CI01000058_01280337_01289153 DNASE2B other upstream 1211840 1278592 ~ 1289874 (+)
CI01000058_00592498_00596709 NA other upstream 1902939 592331 ~ 597171 (+)
CI01000058_00435196_00437830 AGTRAP other upstream 2044366 434913 ~ 455744 (+)
G250039 NA other downstream 2194091 4694408 ~ 4697161 (+)
CI01000058_04864571_04888198 NA other downstream 2326059 4864571 ~ 4888216 (+)

Expression


Co-expression Network