G248516


Basic Information

Item Value
gene id G248516
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 2673375 ~ 2673662 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU282050
GGGAGAATAAAAACCCTTCCTACACCTTTGTTACATGTCTTGTGTTTCTGTGACCTAGTTTTCCCCAGTTTGTTTGATTAGTTCATTTGATTCACCTGTCTAGTTAATCATCTCATCACCTCGTTAAGTTCCCTTTGTTTGTCACATGTATTTAAACCCAGTGTTCTCCTTCACTCCTTGTCCGTTCTCGCTTACTTTTACGTTAACTTGTATGTTATGCTGTCTCTACCCTGTTGGAATCTCCTGTGTTTGATTAAAGACCTACTCGTATACTCATCTTCATCTTTG

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU282050 True 288 lncRNA 0.39 1 2673375 2673662

Neighbor

gene id symbol gene type direction distance location
CI01000058_02650808_02653235 NA coding upstream 20004 2650436 ~ 2653371 (+)
CI01000058_02635467_02636768 NA coding upstream 36390 2635176 ~ 2636985 (+)
CI01000058_02629861_02631891 NA coding upstream 41081 2629690 ~ 2632294 (+)
CI01000058_02592534_02600835 NA coding upstream 71620 2591193 ~ 2601755 (+)
CI01000058_02578534_02589495 NA coding upstream 82834 2578061 ~ 2590541 (+)
CI01000058_02883775_02884290 NA coding downstream 208502 2882164 ~ 2885704 (+)
CI01000058_02911431_02958568 SRGAP2 coding downstream 237769 2911431 ~ 2958568 (+)
CI01000058_02964886_02978501 IKBKE coding downstream 291224 2964886 ~ 2978895 (+)
CI01000058_02979997_03027744 RASSF5 coding downstream 306335 2979997 ~ 3028144 (+)
CI01000058_03034418_03038200 DYRK3 coding downstream 360756 3034418 ~ 3038344 (+)
G248432 NA non-coding upstream 173058 2500110 ~ 2500317 (+)
G248406 NA non-coding upstream 211827 2460916 ~ 2461548 (+)
G248405 NA non-coding upstream 213978 2459047 ~ 2459397 (+)
G248404 NA non-coding upstream 216790 2455687 ~ 2456585 (+)
G248519 NA non-coding downstream 11613 2685275 ~ 2685634 (+)
G248574 NA non-coding downstream 193560 2867222 ~ 2878788 (+)
G248566 NA non-coding downstream 217689 2891351 ~ 2908197 (+)
G248594 NA non-coding downstream 290831 2964493 ~ 2964823 (+)
G248613 NA non-coding downstream 434111 3107773 ~ 3108154 (+)
CI01000058_01794468_01800421 KISS1 other upstream 875643 1794468 ~ 1800421 (+)
G247940 NA other upstream 1216928 1452997 ~ 1456447 (+)
CI01000058_01280337_01289153 DNASE2B other upstream 1385105 1278592 ~ 1289874 (+)
CI01000058_00592498_00596709 NA other upstream 2076204 592331 ~ 597171 (+)
CI01000058_00435196_00437830 AGTRAP other upstream 2217631 434913 ~ 455744 (+)
G250039 NA other downstream 2020746 4694408 ~ 4697161 (+)
CI01000058_04864571_04888198 NA other downstream 2152714 4864571 ~ 4888216 (+)

Expression


Co-expression Network