G249839


Basic Information

Item Value
gene id G249839
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000058
NCBI id null
chromosome length 5213219
location 4115652 ~ 4116392 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU283531
TCTGTGTTGCATGGCTCGGTGATCACAGCTGGTTTAGGAGAGCCATGGCACCGCTGATCAGACACCACCACTCGATCCGACTCACGATTGCACAAGATCTTCCTCTTGCGCTCTCCTTGGCACAAAAGACTGCAATCCTGCCATGGGCCGTACGCATCCCAAAAAAACTGCTGAGGTTTGTCTTCTATGGGAATGTTGTAGGAATACCTGACATCAGGGTTGTAGAGGTTTCCTACGGATAGCACCTGGATAATAATCTCCTCTTCTATGCGGTCAGTGCAGTTGATTCTCTCAACGACATGGTCAGAGCCACTGTATTCAATAACAGCATTCCCCACTCTGACTTCCCTTTTAAAC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU283531 True 357 lncRNA 0.49 3 4115652 4116392

Neighbor

gene id symbol gene type direction distance location
CI01000058_03959155_03965275 SLC2A9L1 coding upstream 150054 3959155 ~ 3965598 (+)
CI01000058_03915537_03946197 ATXN7 coding upstream 167579 3914922 ~ 3948073 (+)
CI01000058_03889526_03896649 SYNPR coding upstream 218897 3889314 ~ 3896755 (+)
CI01000058_03846867_03850723 SYNPR, NAMPTB coding upstream 264929 3846867 ~ 3850723 (+)
CI01000058_03645458_03659734 NA coding upstream 455890 3645458 ~ 3659762 (+)
CI01000058_04174884_04175951 RHOL coding downstream 58408 4174800 ~ 4176830 (+)
CI01000058_04263520_04265153 NA coding downstream 146732 4263124 ~ 4265628 (+)
CI01000058_04272001_04275349 NA coding downstream 155514 4271906 ~ 4275431 (+)
CI01000058_04303891_04308850 NA coding downstream 187412 4303804 ~ 4308997 (+)
CI01000058_04344622_04358133 NA coding downstream 226629 4343021 ~ 4358133 (+)
G249776 NA non-coding upstream 61205 4024700 ~ 4054447 (+)
G249774 NA non-coding upstream 95959 4019469 ~ 4019693 (+)
G249773 NA non-coding upstream 96899 4018497 ~ 4018753 (+)
G249771 NA non-coding upstream 104499 4010954 ~ 4011153 (+)
G249770 NA non-coding upstream 108118 4007315 ~ 4007534 (+)
G249869 NA non-coding downstream 37855 4154247 ~ 4154491 (+)
G249873 NA non-coding downstream 54198 4170590 ~ 4171092 (+)
G249886 NA non-coding downstream 101536 4217928 ~ 4218769 (+)
G249899 NA non-coding downstream 123845 4240237 ~ 4240895 (+)
G249970 NA non-coding downstream 224380 4340772 ~ 4340984 (+)
CI01000058_01794468_01800421 KISS1 other upstream 2317920 1794468 ~ 1800421 (+)
G247940 NA other upstream 2659205 1452997 ~ 1456447 (+)
CI01000058_01280337_01289153 DNASE2B other upstream 2827382 1278592 ~ 1289874 (+)
CI01000058_00592498_00596709 NA other upstream 3518481 592331 ~ 597171 (+)
CI01000058_00435196_00437830 AGTRAP other upstream 3659908 434913 ~ 455744 (+)
G250039 NA other downstream 578016 4694408 ~ 4697161 (+)
CI01000058_04864571_04888198 NA other downstream 709984 4864571 ~ 4888216 (+)

Expression


Co-expression Network