G253013


Basic Information

Item Value
gene id G253013
gene name NA
gene type unknown
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000059
NCBI id null
chromosome length 10376574
location 3471475 ~ 3471909 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU287202
GGCTTGATTACTGCAATGCTCTTCTGGCTGGACTGCCATCATGCACAATCAAGCCTCTACAAATGATTCAGAACGCTGCAGCACGTCTCGTCTTCAACGAGCCCAAAAGAGCCCACGTCACGCCTCTCTTCATCTCTCTTCACTGGCTACCAATTGCTGCTCGCATCAAATTCAAGGCGTTGACGCTTGCTTACAGATCTACCACAGGCTCTGCACCCTCCTACTTCCACTCACTCTTACGAGTCTACACTCCTACCAGAAGCCTACGCTCATTAAAGGAGCGAAGGCTTGTGGTTCCATCACAGAGAGGCACGAAATCACTCTCCAGGACATTCTCGTTCACTGTTCCTTGCTGGTGGAATGATCTTCCTGCCTTTATCCGGAATGCAGAATCCCTGGCAATATTCAAAAGACAGCTGAAAACTCATCTCTTTC

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU287202 True 435 TUCP 0.49 1 3471475 3471909

Neighbor

gene id symbol gene type direction distance location
CI01000059_03121584_03134563 NUP88 coding downstream 336856 3121384 ~ 3134619 (-)
CI01000059_03071218_03071426 NA coding downstream 400049 3070781 ~ 3071426 (-)
CI01000059_03060930_03062564 MIS12 coding downstream 408911 3060337 ~ 3062564 (-)
CI01000059_02961679_02975886 MCAMA coding downstream 495589 2961606 ~ 2975886 (-)
CI01000059_02947966_02952781 TMEM136B coding downstream 518694 2947617 ~ 2952781 (-)
CI01000059_04159631_04163473 RAD51D coding upstream 687722 4159631 ~ 4163703 (-)
CI01000059_04184774_04184941 NA coding upstream 712575 4183944 ~ 4185575 (-)
CI01000059_04302538_04321833 NA coding upstream 830224 4302133 ~ 4322022 (-)
CI01000059_04464003_04469302 NA coding upstream 991952 4463861 ~ 4469302 (-)
CI01000059_04501893_04513422 RCC1L, WBSCR16 coding upstream 1029538 4501447 ~ 4513422 (-)
G253006 NA non-coding downstream 30265 3440724 ~ 3441210 (-)
G253005 NA non-coding downstream 31965 3439274 ~ 3439510 (-)
G253000 NA non-coding downstream 63780 3407469 ~ 3407695 (-)
G252998 NA non-coding downstream 64724 3396689 ~ 3406751 (-)
G252982 NA non-coding downstream 67056 3402373 ~ 3404419 (-)
G253019 NA non-coding upstream 23612 3495521 ~ 3495720 (-)
G253025 NA non-coding upstream 29941 3501850 ~ 3502077 (-)
G253029 NA non-coding upstream 34527 3506436 ~ 3506965 (-)
G253035 NA non-coding upstream 42311 3514220 ~ 3515161 (-)
G253066 NA non-coding upstream 86511 3558420 ~ 3558734 (-)
CI01000059_02096875_02098872 CDC26 other downstream 1371808 2094279 ~ 2098985 (-)
CI01000059_01253451_01254823 NA other downstream 2215813 1251716 ~ 1254823 (-)
CI01000059_00378673_00379901 NA other downstream 3091338 378587 ~ 380137 (-)
G253914 NA other upstream 1281629 4753538 ~ 4754082 (-)
G254203 NA other upstream 1765877 5237786 ~ 5238299 (-)
G255092 NA other upstream 2764197 6236106 ~ 6242792 (-)
G256890 NA other upstream 5509787 8981696 ~ 8982117 (-)
G257014 NA other upstream 5982307 9454216 ~ 9599008 (-)

Expression


Co-expression Network