CI01000069_04599199_04600481 (RL23, RPL23, RPL23.L)


Basic Information

Item Value
gene id CI01000069_04599199_04600481
gene name RL23, RPL23, RPL23.L
gene type coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 4599169 ~ 4600481 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>CI01000069_04599199_04600481.mRNA
GACGTGGTGGGTCATCGGGAGCCAAGTTCCGTATTTCACTGGGTCTCCCAGTGGGAGCGGTCATCAACTGCGCTGACAACACAGGTGCCAAGAACCTGTACATCATATCCGTCAAAGGCATCAAGGGTCGTCTGAACAGGCTCCCTGCCGCTGGTGTGGGCGACATGGTTATGGCCACAGTGAAGAAAGGCAAGCCAGAGCTCAGGAAAAAGGGTGAGTGTTTTCAGAGCCTGCTGCAACTGCACTCTGCTGGCTTTTGGCTTAGAGAAGCATATGTGCTTATACAGCTGTCTCCTTTTAATCTAGTGCATCCTGCGGTGGTGATACGACAGCGGAAGTCGTATCGGCGAAAAGATGGCGTGTTTCTTTACTTCGAAGACAATGCAGGGGTCATAGTAAATAACAAAGGAGAAATGAAAGGATCAGCCATCACAGGACCCGTAGCCAAGGAATGCGCAGACCTGTGGCCCAGGATTGCTTCCAATGCTGGTAGCATTGCCTGAGCGCAAATGTGGCTTGTCGTTTTCAATAAA

Function

symbol description
rpl23 Predicted to enable large ribosomal subunit rRNA binding activity. Predicted to be a structural constituent of ribosome. Predicted to act upstream of or within translation. Predicted to be located in ribosome. Predicted to be part of cytosolic large ribosomal subunit. Is expressed in endodermal cell; intestine; liver; and pancreas. Orthologous to human RPL23 (ribosomal protein L23).

GO:

id name namespace
GO:0000184 nuclear-transcribed mRNA catabolic process, nonsense-mediated decay biological_process

KEGG:

id description
K02894 RP-L23e, RPL23; large subunit ribosomal protein L23e

RNA

RNA id representative length rna type GC content exon number start site end site
CI01000069_04599199_04600481.mRNA True 533 mRNA 0.51 3 4599169 4600481

Neighbor

gene id symbol gene type direction distance location
CI01000069_04595809_04598174 NA coding downstream 995 4595750 ~ 4598174 (-)
CI01000069_04579172_04593867 NA coding downstream 5146 4578609 ~ 4594023 (-)
CI01000069_04574882_04576116 NA coding downstream 23041 4574366 ~ 4576128 (-)
CI01000069_04444787_04454292 NA coding downstream 144877 4444226 ~ 4454292 (-)
CI01000069_04387255_04404199 RARA, RARAA, RARAB coding downstream 194826 4386997 ~ 4404343 (-)
CI01000069_04603992_04607459 NA coding upstream 2618 4603099 ~ 4607586 (-)
CI01000069_04628032_04638137 SGSM3 coding upstream 27372 4627853 ~ 4638137 (-)
CI01000069_04692723_04695795 ELFN2 coding upstream 92011 4692492 ~ 4696567 (-)
CI01000069_04802439_04905601 CACNA1A coding upstream 201116 4801597 ~ 4905886 (-)
CI01000069_04919538_04930550 GTF2F1 coding upstream 318538 4919019 ~ 4930550 (-)
G276052 NA non-coding downstream 41505 4555209 ~ 4557664 (-)
G276042 NA non-coding downstream 71289 4527082 ~ 4527880 (-)
G275770 NA non-coding downstream 383479 4143168 ~ 4215690 (-)
G276064 NA non-coding upstream 13373 4613854 ~ 4624902 (-)
G276129 NA non-coding upstream 64689 4665170 ~ 4665413 (-)
G276133 NA non-coding upstream 68851 4669332 ~ 4669811 (-)
G276094 NA non-coding upstream 98790 4699271 ~ 4703469 (-)
G276114 NA non-coding upstream 103571 4704052 ~ 4710962 (-)
CI01000069_03804630_03807180 PRMT1.S, PRMT1 other downstream 792092 3804616 ~ 3807180 (-)
CI01000069_03768812_03787588 BRSK1 other downstream 829949 3765673 ~ 3787588 (-)
CI01000069_03415853_03417644 LIMD2 other downstream 1172795 3412973 ~ 3417644 (-)
G275699 NA other downstream 1521001 2992504 ~ 3078168 (-)
CI01000069_04932463_04940554 NA other upstream 339040 4932144 ~ 4941471 (-)

Expression


Co-expression Network

Homologous

species gene id symbol gene type chromosome NCBI id location
grasscarp (Ctenopharyngodon idella) G25515 NA non-coding CI01000004 null 1426692 ~ 1427877 (-)