G275856



Basic Information


Item Value
gene id G275856
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 3261296 ~ 3261504 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU312952
TATTTATGAAAGAAATCTCACAGGCTGCATTTTTGAATATATTTTAAAATGTCATTTTTTCATGTGTTGCAGAGCTGAATTTTCAGCATCATTACTCCAGTCTTCACTGTCATATGATCCTTCAGAAATCATTCAAATATGATGATTTGATGCCTAACAAACATTTCTTATTATTATCAATGATGAAAATATTTTTTGTGAAACCGTAA

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU312952 True 209 lncRNA 0.28 1 3261296 3261504

Neighbor


gene id symbol gene type direction distance location
CI01000069_03242808_03248880 NA coding downstream 12416 3241819 ~ 3248880 (-)
CI01000069_03032171_03032924 NA coding downstream 228372 3031990 ~ 3032924 (-)
CI01000069_03027056_03028752 APNL coding downstream 232544 3026925 ~ 3028752 (-)
CI01000069_03014089_03015762 ITPRIPL2 coding downstream 244790 3012696 ~ 3016506 (-)
CI01000069_02997434_03008924 NA coding downstream 252372 2997275 ~ 3008924 (-)
CI01000069_03298533_03302831 CCDC47 coding upstream 36693 3298197 ~ 3302831 (-)
CI01000069_03315611_03353645 KCNH6, KCNH6A coding upstream 54008 3315512 ~ 3353733 (-)
CI01000069_03365921_03371931 GFAP coding upstream 103959 3365463 ~ 3371944 (-)
CI01000069_03382399_03395900 MAP3K3 coding upstream 120628 3382132 ~ 3395900 (-)
CI01000069_03415853_03417644 LIMD2 coding upstream 152621 3412973 ~ 3417644 (-)
G275843 NA non-coding downstream 41255 3219809 ~ 3220041 (-)
G275658 NA non-coding downstream 366330 2892738 ~ 2894966 (-)
G275681 NA non-coding downstream 491984 2768956 ~ 2769312 (-)
G275672 NA non-coding downstream 620762 2640335 ~ 2640534 (-)
G275671 NA non-coding downstream 621258 2639787 ~ 2640038 (-)
G275814 NA non-coding upstream 19408 3280912 ~ 3284191 (-)
G275772 NA non-coding upstream 44985 3306489 ~ 3312896 (-)
G275876 NA non-coding upstream 95717 3357221 ~ 3357421 (-)
G275878 NA non-coding upstream 98984 3360488 ~ 3360701 (-)
G275750 NA non-coding upstream 334217 3595721 ~ 3627754 (-)
G275699 NA other downstream 183128 2992504 ~ 3078168 (-)
CI01000069_02589498_02621318 SYT3 other downstream 630980 2589469 ~ 2621641 (-)
CI01000069_01645966_01647142 NA other downstream 1613970 1644522 ~ 1647326 (-)
G275178 NA other downstream 2315492 926923 ~ 945804 (-)
CI01000069_03768812_03787588 BRSK1 other upstream 504169 3765673 ~ 3787588 (-)
CI01000069_03804630_03807180 PRMT1.S, PRMT1 other upstream 543112 3804616 ~ 3807180 (-)
CI01000069_04932463_04940554 NA other upstream 1678017 4932144 ~ 4941471 (-)

Expression



Co-expression Network