G275920



Basic Information


Item Value
gene id G275920
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information


Item Value
chromosome id CI01000069
NCBI id null
chromosome length 5329268
location 3736654 ~ 3736958 (-)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence


>TU313017
GCCAACAAGAGCACCTGTGGCCAACAGTTCATCTGATGATGTAGATTTTTTCGCTTCTTTGAAACCGACAACACATGAAGCCAGCAAAGAGTTGGATGGATATCTGGCCTGTGTTTCAGACACAGGGAGTCTCTGCTCACGTTCCCTGCTATTTGCAGCCTCTCTATCAAGACTAATACACCTCTTCCTGCATCGGCTGCATTGAAGAGGCTTTTCAGCACAGCAGGATTGCTTTTTAGCCCCAAAAGAGCCAGACTTGACACTCACAATTTTGAAAATCAGCTTCTGCTTAAGTTAAATCCAAG

Function


GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA


RNA id representative length rna type GC content exon number start site end site
TU313017 True 305 lncRNA 0.45 1 3736654 3736958

Neighbor


gene id symbol gene type direction distance location
CI01000069_03721128_03722393 NA coding downstream 14261 3720944 ~ 3722393 (-)
CI01000069_03678617_03697993 PIH1D1 coding downstream 37898 3678298 ~ 3698756 (-)
CI01000069_03670799_03677837 NA coding downstream 58811 3670271 ~ 3677843 (-)
CI01000069_03667639_03669979 NA coding downstream 66675 3667620 ~ 3669979 (-)
CI01000069_03578433_03584741 BAXB coding downstream 151423 3578433 ~ 3585231 (-)
CI01000069_03739653_03764284 CPT1CB coding upstream 1492 3738450 ~ 3764284 (-)
CI01000069_03768812_03787588 BRSK1 coding upstream 31634 3765673 ~ 3787588 (-)
CI01000069_03804630_03807180 PRMT1.S, PRMT1 coding upstream 67672 3804616 ~ 3807180 (-)
CI01000069_03871972_03884153 NA coding upstream 134967 3871925 ~ 3884153 (-)
CI01000069_03939251_03942780 RCN3 coding upstream 202246 3939204 ~ 3943095 (-)
G275754 NA non-coding downstream 100391 3612753 ~ 3636263 (-)
G275828 NA non-coding downstream 103540 3614318 ~ 3633114 (-)
G275750 NA non-coding downstream 108900 3595721 ~ 3627754 (-)
G275826 NA non-coding downstream 121815 3607452 ~ 3614839 (-)
G275878 NA non-coding downstream 375953 3360488 ~ 3360701 (-)
G275921 NA non-coding upstream 514 3737472 ~ 3737689 (-)
G275756 NA non-coding upstream 54631 3791589 ~ 3796952 (-)
G275790 NA non-coding upstream 86434 3823392 ~ 3826580 (-)
G275773 NA non-coding upstream 102276 3839234 ~ 3843586 (-)
G275827 NA non-coding upstream 111623 3848581 ~ 3848979 (-)
CI01000069_03415853_03417644 LIMD2 other downstream 310280 3412973 ~ 3417644 (-)
G275699 NA other downstream 658486 2992504 ~ 3078168 (-)
CI01000069_02997434_03008924 NA other downstream 736221 2997275 ~ 3008924 (-)
CI01000069_02589498_02621318 SYT3 other downstream 1106338 2589469 ~ 2621641 (-)
CI01000069_04932463_04940554 NA other upstream 1202563 4932144 ~ 4941471 (-)

Expression



Co-expression Network