G283457


Basic Information

Item Value
gene id G283457
gene name NA
gene type non-coding
species grasscarp (Ctenopharyngodon idella)
category of species economic fish

Chromosome Information

Item Value
chromosome id CI01000071
NCBI id null
chromosome length 5214881
location 4982595 ~ 4989704 (+)
genome version v1_2015/06_NatureGenetics_grasscarp_Genome

Sequence

>TU321238
TCCAACTCCCCTAGAGTTAAACAGTTGAGTTTTACCGTTTTCGAATCCATTCAGCCGATCTCCGGGTCTGGCGGTACCACTTTTAGCATAGCTTAGCACAGTTCATTGAATCTGATTAGACCGTTAGCATCTCGTTAAAAAATGACCAAAGAGTTTCAATATTTTTCCTATTTAAAACTTGACTCTTCTGTAGTTACATCGTGTACTAAGACCGACAGAAAATGAAAAGTAGGCCGATATGACTAGGAACTATACTCTCATTCCGGCGTAATAATCAAGGAACTTTGCTGCCGT

Function

GO:

id name namespace
GO:0016071 mRNA metabolic process biological_process
GO:0000375 RNA splicing, via transesterification reactions biological_process
GO:0000377 RNA splicing, via transesterification reactions with bulged adenosine as nucleophile biological_process
GO:0006397 mRNA processing biological_process
GO:0000398 mRNA splicing, via spliceosome biological_process
GO:0016607 nuclear speck cellular_component
GO:0005681 spliceosomal complex cellular_component
GO:0005685 U1 snRNP cellular_component

KEGG:

id description
ko03040 Spliceosome

RNA

RNA id representative length rna type GC content exon number start site end site
TU321238 True 294 lncRNA 0.40 2 4982595 4989704

Neighbor

gene id symbol gene type direction distance location
CI01000071_04982029_04982493 NA coding upstream 55 4981356 ~ 4982540 (+)
CI01000071_04903716_04959830 KSR2 coding upstream 22734 4903716 ~ 4959861 (+)
CI01000071_04851502_04865548 KSR2 coding upstream 117047 4851502 ~ 4865548 (+)
CI01000071_04834539_04839129 WSB2 coding upstream 143240 4834326 ~ 4839355 (+)
CI01000071_04825708_04831021 NA coding upstream 151528 4825708 ~ 4831067 (+)
CI01000071_05002535_05056745 NOS1 coding downstream 12485 5002189 ~ 5057408 (+)
CI01000071_05081168_05081463 NA coding downstream 91464 5081168 ~ 5082153 (+)
CI01000071_05082669_05087793 NIPSNAP1 coding downstream 92596 5082300 ~ 5087817 (+)
CI01000071_05102723_05110135 GATSL3 coding downstream 113019 5102723 ~ 5110220 (+)
CI01000071_05142025_05161947 RNFT2 coding downstream 152321 5142025 ~ 5162294 (+)
G283422 NA non-coding upstream 12406 4969068 ~ 4970189 (+)
G283423 NA non-coding upstream 17154 4962938 ~ 4965441 (+)
G283442 NA non-coding upstream 158807 4822773 ~ 4823788 (+)
G283440 NA non-coding upstream 164366 4817956 ~ 4818229 (+)
G283557 NA non-coding downstream 74928 5064632 ~ 5064913 (+)
G283580 NA non-coding downstream 76087 5065791 ~ 5066007 (+)
G283570 NA non-coding downstream 123893 5113597 ~ 5115165 (+)
G283577 NA non-coding downstream 155058 5144762 ~ 5196867 (+)
G282080 NA other upstream 1926064 3056084 ~ 3056531 (+)
CI01000071_02815324_02834097 NA other upstream 2153991 2815127 ~ 2835525 (+)
CI01000071_01374449_01376813 NA other upstream 3604925 1373996 ~ 1377670 (+)
G280443 NA other upstream 4060499 905217 ~ 922096 (+)
CI01000071_00792254_00802384 SLC6A4B, SLC6A4 other upstream 4179278 791346 ~ 803317 (+)

Expression


Co-expression Network